TPM2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52895-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TPM2 Reagents
CRO Services
Product recommended

All TPM2 Reagents
TPM2 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
855 bp
Description
Full length Clone DNA of Mouse tropomyosin 2, beta with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPM2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Tpm-2 cDNA ORF Clone, Mouse;Trop-2 cDNA ORF Clone, Mouse
TPM2 Background Information
Full Name
tropomyosin 2 (beta)

TPM2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TPM2 cDNA ORF Clone in Cloning Vector, Rat RG81117-U
TPM2 cDNA ORF Clone, Rat, untagged RG81117-UT
TPM2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81117-ACGLN
TPM2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81117-ACG
TPM2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81117-ANG
TPM2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81117-ACR
TPM2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81117-ANR
TPM2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81117-CF
TPM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81117-NF
TPM2 cDNA ORF Clone, Rat, C-His tag RG81117-CH
TPM2 cDNA ORF Clone, Rat, N-His tag RG81117-NH
TPM2 cDNA ORF Clone, Rat, C-HA tag RG81117-CY
TPM2 cDNA ORF Clone, Rat, N-HA tag RG81117-NY
TPM2 cDNA ORF Clone, Rat, C-Myc tag RG81117-CM
TPM2 cDNA ORF Clone, Rat, N-Myc tag RG81117-NM
TPM2 qPCR Primer Pairs, Rat RP301074

TPM2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TPM2 cDNA ORF Clone in Cloning Vector, Mouse MG52895-G
TPM2 cDNA ORF Clone, Mouse, untagged MG52895-UT
TPM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52895-ACG
TPM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52895-ACGLN
TPM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52895-ANG
TPM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52895-ACR
TPM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52895-ANR
TPM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52895-CF
TPM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52895-NF
TPM2 cDNA ORF Clone, Mouse, C-His tag MG52895-CH
TPM2 cDNA ORF Clone, Mouse, N-His tag MG52895-NH
TPM2 cDNA ORF Clone, Mouse, C-HA tag MG52895-CY
TPM2 cDNA ORF Clone, Mouse, C-Myc tag MG52895-CM
TPM2 cDNA ORF Clone, Mouse, N-Myc tag MG52895-NM

TPM2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPM2 cDNA ORF Clone in Cloning Vector, Human HG16859-U
TPM2 cDNA ORF Clone, Human, untagged HG16859-UT
TPM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16859-ACG
TPM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16859-ACGLN
TPM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16859-ANG
TPM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16859-ACR
TPM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16859-ANR
TPM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16859-CF
TPM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16859-NF
TPM2 cDNA ORF Clone, Human, C-His tag HG16859-CH
TPM2 cDNA ORF Clone, Human, N-His tag HG16859-NH
TPM2 cDNA ORF Clone, Human, C-HA tag HG16859-CY
TPM2 cDNA ORF Clone, Human, N-HA tag HG16859-NY
TPM2 cDNA ORF Clone, Human, C-Myc tag HG16859-CM
TPM2 cDNA ORF Clone, Human, N-Myc tag HG16859-NM
info info
添加购物车成功! 添加购物车失败!