Quick Order

Text Size:AAA

Mouse TPM1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse TPM1 cDNA Clone Product Information
NCBI RefSeq:NM_001164253.1
RefSeq ORF Size:747bp
cDNA Description:Full length Clone DNA of Mus musculus tropomyosin 1, alpha with C terminal His tag.
Gene Synonym:TM2, Tm3, Tmpa, Tpm-1, AA986836, AI854628, alpha-TM
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.

References
  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.
  • Size / Price
    Catalog: MG51274-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"