TOR1AIP2 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52252-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOR1AIP2 Reagents
CRO Services
Product recommended

All TOR1AIP2 Reagents
TOR1AIP2 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
396 bp
Description
Full length Clone DNA of Mouse torsin A interacting protein 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOR1AIP2 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
1110020D10Rik cDNA ORF Clone, Mouse;15kDa cDNA ORF Clone, Mouse;A130072J07 cDNA ORF Clone, Mouse;AA103493 cDNA ORF Clone, Mouse;AW060462 cDNA ORF Clone, Mouse;AW610675 cDNA ORF Clone, Mouse;C77739 cDNA ORF Clone, Mouse;Ifrg15 cDNA ORF Clone, Mouse;Lull1 cDNA ORF Clone, Mouse
TOR1AIP2 Background Information
Full Name
torsin A interacting protein 2

TOR1AIP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TOR1AIP2 cDNA ORF Clone in Cloning Vector, Rat RG81656-G
TOR1AIP2 cDNA ORF Clone, Rat, untagged RG81656-UT
TOR1AIP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81656-ACGLN
TOR1AIP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81656-ACG
TOR1AIP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81656-ACR
TOR1AIP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81656-CF
TOR1AIP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81656-NF
TOR1AIP2 cDNA ORF Clone, Rat, C-His tag RG81656-CH
TOR1AIP2 cDNA ORF Clone, Rat, N-His tag RG81656-NH
TOR1AIP2 cDNA ORF Clone, Rat, C-HA tag RG81656-CY
TOR1AIP2 cDNA ORF Clone, Rat, N-HA tag RG81656-NY
TOR1AIP2 cDNA ORF Clone, Rat, C-Myc tag RG81656-CM
TOR1AIP2 cDNA ORF Clone, Rat, N-Myc tag RG81656-NM

TOR1AIP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOR1AIP2 cDNA ORF Clone in Cloning Vector, Mouse MG52252-G
TOR1AIP2 cDNA ORF Clone, Mouse, untagged MG52252-UT
TOR1AIP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52252-ACG
TOR1AIP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52252-ACGLN
TOR1AIP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52252-ACR
TOR1AIP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52252-CF
TOR1AIP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52252-NF
TOR1AIP2 cDNA ORF Clone, Mouse, C-His tag MG52252-CH
TOR1AIP2 cDNA ORF Clone, Mouse, N-His tag MG52252-NH
TOR1AIP2 cDNA ORF Clone, Mouse, C-HA tag MG52252-CY
TOR1AIP2 cDNA ORF Clone, Mouse, C-Myc tag MG52252-CM
TOR1AIP2 cDNA ORF Clone, Mouse, N-Myc tag MG52252-NM
TOR1AIP2 qPCR Primer Pairs, Mouse MP202125
info info
添加购物车成功! 添加购物车失败!