TOR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52340-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOR1A Reagents
CRO Services
Product recommended

All TOR1A Reagents
TOR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse torsin family 1, member A (torsin A) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
DQ2 cDNA ORF Clone, Mouse;Dyt1 cDNA ORF Clone, Mouse;torsinA cDNA ORF Clone, Mouse
TOR1A Background Information
Full Name
torsin family 1, member A (torsin A)

TOR1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TOR1A cDNA ORF Clone in Cloning Vector, Rat RG83532-U
TOR1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83532-ACGLN

TOR1A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOR1A cDNA ORF Clone in Cloning Vector, Mouse MG52340-G
TOR1A cDNA ORF Clone, Mouse, untagged MG52340-UT
TOR1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52340-ACGLN
TOR1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52340-ACG
TOR1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52340-ACR
TOR1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52340-NF
TOR1A cDNA ORF Clone, Mouse, C-His tag MG52340-CH
TOR1A cDNA ORF Clone, Mouse, N-His tag MG52340-NH
TOR1A cDNA ORF Clone, Mouse, C-HA tag MG52340-CY
TOR1A cDNA ORF Clone, Mouse, N-HA tag MG52340-NY
TOR1A cDNA ORF Clone, Mouse, C-Myc tag MG52340-CM
TOR1A cDNA ORF Clone, Mouse, N-Myc tag MG52340-NM
TOR1A qPCR Primer Pairs, Mouse MP202213

TOR1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOR1A cDNA ORF Clone in Cloning Vector, Human HG16689-U
TOR1A cDNA ORF Clone, Human, untagged HG16689-UT
TOR1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16689-ACG
TOR1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16689-ACGLN
TOR1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16689-ACR
TOR1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16689-CF
TOR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16689-NF
TOR1A cDNA ORF Clone, Human, C-His tag HG16689-CH
TOR1A cDNA ORF Clone, Human, N-His tag HG16689-NH
TOR1A cDNA ORF Clone, Human, C-HA tag HG16689-CY
TOR1A cDNA ORF Clone, Human, N-HA tag HG16689-NY
TOR1A cDNA ORF Clone, Human, C-Myc tag HG16689-CM
TOR1A cDNA ORF Clone, Human, N-Myc tag HG16689-NM
info info
添加购物车成功! 添加购物车失败!