TOMM70A cDNA ORF Clone, Mouse, untagged

Cat: MG51573-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOMM70A Reagents
CRO Services
Product recommended

All TOMM70A Reagents
TOMM70A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1836 bp
Description
Full length Clone DNA of Mouse translocase of outer mitochondrial membrane 70 homolog A (yeast).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOMM70A cDNA ORF Clone, Mouse, untagged Alternative Names
2610044B22Rik cDNA ORF Clone, Mouse;D16Ium22 cDNA ORF Clone, Mouse;D16Ium22e cDNA ORF Clone, Mouse;D16Wsu109e cDNA ORF Clone, Mouse;mKIAA0719 cDNA ORF Clone, Mouse;Tom70 cDNA ORF Clone, Mouse
TOMM70A Background Information
Full Name
translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)

TOMM70A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOMM70A cDNA ORF Clone in Cloning Vector, Mouse MG51573-U
TOMM70A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51573-ACGLN
TOMM70A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51573-ACG
TOMM70A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51573-ANG
TOMM70A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51573-ACR
TOMM70A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51573-ANR
TOMM70A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51573-CF
TOMM70A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51573-NF
TOMM70A cDNA ORF Clone, Mouse, C-His tag MG51573-CH
TOMM70A cDNA ORF Clone, Mouse, N-His tag MG51573-NH
TOMM70A cDNA ORF Clone, Mouse, C-HA tag MG51573-CY
TOMM70A cDNA ORF Clone, Mouse, N-HA tag MG51573-NY
TOMM70A cDNA ORF Clone, Mouse, C-Myc tag MG51573-CM
TOMM70A cDNA ORF Clone, Mouse, N-Myc tag MG51573-NM
TOMM70A qPCR Primer Pairs, Mouse MP201456

TOMM70A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOMM70A cDNA ORF Clone in Cloning Vector, Human HG19654-U
TOMM70A cDNA ORF Clone, Human, untagged HG19654-UT
TOMM70A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19654-ACGLN
TOMM70A cDNA ORF Clone, Human, C-GFPSpark® tag HG19654-ACG
TOMM70A cDNA ORF Clone, Human, N-GFPSpark® tag HG19654-ANG
TOMM70A cDNA ORF Clone, Human, C-OFPSpark® tag HG19654-ACR
TOMM70A cDNA ORF Clone, Human, N-OFPSpark® tag HG19654-ANR
TOMM70A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19654-CF
TOMM70A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19654-NF
TOMM70A cDNA ORF Clone, Human, C-His tag HG19654-CH
TOMM70A cDNA ORF Clone, Human, N-His tag HG19654-NH
TOMM70A cDNA ORF Clone, Human, C-HA tag HG19654-CY
TOMM70A cDNA ORF Clone, Human, N-HA tag HG19654-NY
TOMM70A cDNA ORF Clone, Human, C-Myc tag HG19654-CM
TOMM70A cDNA ORF Clone, Human, N-Myc tag HG19654-NM
info info
添加购物车成功! 添加购物车失败!