TOB1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52624-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOB1 Reagents
CRO Services
Product recommended

All TOB1 Reagents
TOB1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1089 bp
Description
Full length Clone DNA of Mouse transducer of ErbB-2.1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOB1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Tob cDNA ORF Clone, Mouse;Trob cDNA ORF Clone, Mouse
TOB1 Background Information
Full Name
transducer of ERBB2, 1

TOB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOB1 cDNA ORF Clone in Cloning Vector, Mouse MG52624-G
TOB1 cDNA ORF Clone, Mouse, untagged MG52624-UT
TOB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52624-ACGLN
TOB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52624-ACG
TOB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52624-ANG
TOB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52624-ACR
TOB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52624-ANR
TOB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52624-CF
TOB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52624-NF
TOB1 cDNA ORF Clone, Mouse, C-His tag MG52624-CH
TOB1 cDNA ORF Clone, Mouse, N-His tag MG52624-NH
TOB1 cDNA ORF Clone, Mouse, C-HA tag MG52624-CY
TOB1 cDNA ORF Clone, Mouse, N-HA tag MG52624-NY
TOB1 cDNA ORF Clone, Mouse, C-Myc tag MG52624-CM
TOB1 qPCR Primer Pairs, Mouse MP202495

TOB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOB1 cDNA ORF Clone in Cloning Vector, Human HG15424-G
TOB1 cDNA ORF Clone, Human, untagged HG15424-UT
TOB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15424-ACG
TOB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15424-ACGLN
TOB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15424-ANG
TOB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15424-ACR
TOB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15424-ANR
TOB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15424-CF
TOB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15424-NF
TOB1 cDNA ORF Clone, Human, C-His tag HG15424-CH
TOB1 cDNA ORF Clone, Human, N-His tag HG15424-NH
TOB1 cDNA ORF Clone, Human, C-HA tag HG15424-CY
TOB1 cDNA ORF Clone, Human, N-HA tag HG15424-NY
TOB1 cDNA ORF Clone, Human, C-Myc tag HG15424-CM
TOB1 cDNA ORF Clone, Human, N-Myc tag HG15424-NM
TOB1 qPCR Primer Pairs, Human HP104048
info info
添加购物车成功! 添加购物车失败!