After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse RANKL/OPGL/TNFSF11/CD254 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse TNFSF11 cDNA Clone Product Information
NCBI RefSeq:NM_011613.3
RefSeq ORF Size:951bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 11.
Gene Synonym:ODF, OPG, OPGL, RANKL, Ly109l, Trance
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mTNFSF11
Restriction Site:HindIII + XbaI (6.1kb + 0.95kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 9 G/A , 342 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TNFSF11 Gene Plasmid Map
Mouse TNFSF11 / CD254 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

References
  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • Size / Price
    Catalog: MG50343-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse TNFSF11 / CD254 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"