Text Size:AAA

Mouse TNFR2/TNFRSF1B/CD120b Gene ORF cDNA clone expression plasmid

  • Mouse TNFRSF1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Mouse TNFRSF1B cDNA Clone Product Information
NCBI RefSeq:NM_011610.3
RefSeq ORF Size:1425bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 1b.
Gene Synonym:p75, TNFBR, Tnfr2, CD120b, TNF-R2, TNFR80, TNFRII, Tnfr-1, TNF-R75, TNF-R-II, TNF-alphaR2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mTNFRSF1B
Restriction Site:KpnI + XbaI (6.1kb + 1.43kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6G>A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TNFRSF1B qPCR primers for gene expression analysis, MP200158 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TNFRSF1B Gene Plasmid Map
Mouse TNFRSF1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), also known as Tumor necrosis factor receptor 2 (TNFR2) or CD120b antigen, is a member of the tumor necrosis factor receptor superfamily. TNFR2/CD120b/TNFRSF1B is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. TNFR2/CD120b/TNFRSF1B is not a major contributing factor to the genetic risk of type 2 diabetes, its associated peripheral neuropathy and hypertension and related metabolic traits in North Indians. Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B) has been reported to be associated with SLE risk in Japanese populations. TNFR2/CD120b/TNFRSF1B serves as a receptor with high affinity for TNFSF2 and approximately 5-fold lower affinity for homotrimeric TNFSF1. This receptor mediates most of the metabolic effects of TNF-alpha. Isoform 2 blocks TNF-alpha-induced apoptosis, which suggests that it regulates TNF-alpha function by antagonizing its biological activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Komata T, et al. (1999) Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens. 53(6): 527-33.
  • Tsuchiya N, et al. (2001) Analysis of the association of HLA-DRB1, TNFalpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun. 2(6): 317-22.
  • Guo G, et al. (1999) Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol. 277(5): 766-72.
  • Size / Price
    Catalog: MG50128-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"