Quick Order

Mouse TACI/TNFRSF13B(CD267) Gene ORF cDNA clone expression plasmid, N-His tag

  • Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
DatasheetReviewsRelated ProductsProtocols
Mouse TNFRSF13B cDNA Clone Product Information
NCBI RefSeq:NM_021349.1
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 13b with N terminal His tag.
Gene Synonym:Taci, 1200009E08Rik
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mTNFRSF13B
Restriction Site:KpnI + XbaI (6kb + 0.84kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with TNFRSF13B qPCR primers for gene expression analysis, MP200160 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TNFRSF13B Gene Plasmid Map
Mouse TNFRSF13B natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.

References
  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.
  • Size / Price
    Catalog: MG50130-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"