RANK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50490-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RANK Reagents
CRO Services
Product recommended

All RANK Reagents
RANK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1917 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor receptor superfamily, member 11a with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.92kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RANK cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RANK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Mouse TNFRSF11A Gene Expression validated Image 16924
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
RANK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Ly109 cDNA ORF Clone, Mouse;mRANK cDNA ORF Clone, Mouse;ODFR cDNA ORF Clone, Mouse;OFE cDNA ORF Clone, Mouse;Rank cDNA ORF Clone, Mouse;TRANCE-R cDNA ORF Clone, Mouse
RANK Background Information

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.

Full Name
tumor necrosis factor receptor superfamily member 11a
References
  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
  • RANK cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Rat RG80160-G
    RANK cDNA ORF Clone, Rat, untagged RG80160-UT
    RANK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80160-ACGLN
    RANK cDNA ORF Clone, Rat, C-GFPSpark® tag RG80160-ACG
    RANK cDNA ORF Clone, Rat, C-OFPSpark® tag RG80160-ACR
    RANK cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80160-CF
    RANK cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80160-NF
    RANK cDNA ORF Clone, Rat, C-His tag RG80160-CH
    RANK cDNA ORF Clone, Rat, N-His tag RG80160-NH
    RANK cDNA ORF Clone, Rat, C-HA tag RG80160-CY
    RANK cDNA ORF Clone, Rat, N-HA tag RG80160-NY
    RANK cDNA ORF Clone, Rat, C-Myc tag RG80160-CM
    RANK cDNA ORF Clone, Rat, N-Myc tag RG80160-NM
    RANK qPCR Primer Pairs, Rat RP300155

    RANK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Mouse MG50490-M
    RANK cDNA ORF Clone, Mouse, untagged MG50490-UT
    RANK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50490-ACG
    RANK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50490-ACGLN
    RANK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50490-ACR
    RANK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50490-NF
    RANK cDNA ORF Clone, Mouse, C-His tag MG50490-CH
    RANK cDNA ORF Clone, Mouse, N-His tag MG50490-NH
    RANK cDNA ORF Clone, Mouse, C-HA tag MG50490-CY
    RANK cDNA ORF Clone, Mouse, N-HA tag MG50490-NY
    RANK cDNA ORF Clone, Mouse, C-Myc tag MG50490-CM
    RANK cDNA ORF Clone, Mouse, N-Myc tag MG50490-NM
    RANK qPCR Primer Pairs, Mouse MP200484

    RANK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RANK cDNA ORF Clone in Cloning Vector, Human HG16078-G
    RANK cDNA ORF Clone, Human, untagged HG16078-UT
    RANK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16078-ACGLN
    RANK cDNA ORF Clone, Human, C-GFPSpark® tag HG16078-ACG
    RANK cDNA ORF Clone, Human, C-OFPSpark® tag HG16078-ACR
    RANK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16078-CF
    RANK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16078-NF
    RANK cDNA ORF Clone, Human, C-His tag HG16078-CH
    RANK cDNA ORF Clone, Human, N-His tag HG16078-NH
    RANK cDNA ORF Clone, Human, C-HA tag HG16078-CY
    RANK cDNA ORF Clone, Human, N-HA tag HG16078-NY
    RANK cDNA ORF Clone, Human, C-Myc tag HG16078-CM
    RANK cDNA ORF Clone, Human, N-Myc tag HG16078-NM
    info info
    添加购物车成功! 添加购物车失败!