After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TNFRSF11A Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse TNFRSF11A cDNA Clone Product Information
NCBI RefSeq:NM_009399.3
RefSeq ORF Size:1878bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 11a with C terminal His tag.
Gene Synonym:OFE, ODFR, Rank, Ly109, mRANK, TRANCE-R
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TNFRSF11A is a member of the TNF-receptor superfamily. In mouse, it is also known as CD265. TNFRSF11A contains 4 TNFR-Cys repeats and is widely expressed with high levels in skeletal muscle, thymus, liver, colon, small intestine and adrenal gland. It is an essential mediator for osteoclast and lymph node development. TNFRSF11A and its ligand are important regulators of the interaction between T cells and dendritic cells. It can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. Defects in TNFRSF11A can cause familial expansile osteolysis (FEO). FEO is a rare autosomal dominant bone disorder characterized by focal areas of increased bone remodeling. Defects in TNFRSF11A also can cause Paget disease of bone type 2 (PDB2). PDB2 is a bone-remodeling disorder with clinical similarities to FEO. Defects in TNFRSF11A are the cause of osteopetrosis autosomal recessive type 7 which characterized by abnormally dense bone, due to defective resorption of immature bone.

References
  • Darnay B G, et al. (1998) Characterization of the intracellular domain of receptor activator of NF-kappaB (RANK). Interaction with tumor necrosis factor receptor-associated factors and activation of NF-kappab and c-Jun N-terminal kinase. J Biol Chem. 273(32):20551-5.
  • Darnay B G, et al. (1999) Activation of NF-kappaB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-kappaB-inducing kinase. Identification of a novel TRAF6 interaction motif. J Biol Chem. 274(12):7724-31.
  • Galibert L, et al. (1998) The involvement of multiple tumor necrosis factor receptor (TNFR)-associated factors in the signaling mechanisms of receptor activator of NF-kappaB, a member of the TNFR superfamily. J Biol Chem. 273(51):34120-7.
  • Size / Price
    Catalog: MG50490-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"