Quick Order

Text Size:AAA

Mouse TRAIL R2/CD262/TNFRSF10B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse TNFRSF10B cDNA Clone Product Information
NCBI RefSeq:NM_020275.4
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 10b.
Gene Synonym:MK, DR5, Ly98, KILLER, TRICKB, TRAILR2, TRICK2A, TRICK2B, Tnfrsf10b
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

References
  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Catalog: MG50412-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"