TMEM9B cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52213-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM9B Reagents
CRO Services
Product recommended

All TMEM9B Reagents
TMEM9B cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Mouse TMEM9 domain family, member B with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM9B cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2310004K06Rik cDNA ORF Clone, Mouse;AW539847 cDNA ORF Clone, Mouse;D7H11orf15 cDNA ORF Clone, Mouse;ICRFP703B1614Q5.3 cDNA ORF Clone, Mouse
TMEM9B Background Information
Full Name
TMEM9 domain family, member B

TMEM9B cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TMEM9B cDNA ORF Clone in Cloning Vector, Cynomolgus CG90729-G
TMEM9B cDNA ORF Clone, Cynomolgus, untagged CG90729-UT
TMEM9B Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90729-ACGLN
TMEM9B cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90729-ACG
TMEM9B cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90729-ACR
TMEM9B cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90729-CF
TMEM9B cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90729-NF
TMEM9B cDNA ORF Clone, Cynomolgus, C-His tag CG90729-CH
TMEM9B cDNA ORF Clone, Cynomolgus, N-His tag CG90729-NH
TMEM9B cDNA ORF Clone, Cynomolgus, C-HA tag CG90729-CY
TMEM9B cDNA ORF Clone, Cynomolgus, N-HA tag CG90729-NY
TMEM9B cDNA ORF Clone, Cynomolgus, C-Myc tag CG90729-CM
TMEM9B cDNA ORF Clone, Cynomolgus, N-Myc tag CG90729-NM

TMEM9B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM9B cDNA ORF Clone in Cloning Vector, Mouse MG52213-G
TMEM9B cDNA ORF Clone, Mouse, untagged MG52213-UT
TMEM9B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52213-ACGLN
TMEM9B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52213-ACG
TMEM9B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52213-ACR
TMEM9B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52213-CF
TMEM9B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52213-NF
TMEM9B cDNA ORF Clone, Mouse, C-His tag MG52213-CH
TMEM9B cDNA ORF Clone, Mouse, N-His tag MG52213-NH
TMEM9B cDNA ORF Clone, Mouse, C-HA tag MG52213-CY
TMEM9B cDNA ORF Clone, Mouse, C-Myc tag MG52213-CM
TMEM9B cDNA ORF Clone, Mouse, N-Myc tag MG52213-NM
TMEM9B qPCR Primer Pairs, Mouse MP202086

TMEM9B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM9B cDNA ORF Clone in Cloning Vector, Human HG25269-U
info info
添加购物车成功! 添加购物车失败!