TMEM55A cDNA ORF Clone, Mouse, N-His tag

Cat: MG51527-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM55A Reagents
CRO Services
Product recommended

All TMEM55A Reagents
TMEM55A cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
774 bp
Description
Full length Clone DNA of Mouse transmembrane protein 55A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM55A cDNA ORF Clone, Mouse, N-His tag Alternative Names
2610319K07Rik cDNA ORF Clone, Mouse;AI315591 cDNA ORF Clone, Mouse;AV001360 cDNA ORF Clone, Mouse
TMEM55A Background Information
Full Name
transmembrane protein 55A

TMEM55A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM55A cDNA ORF Clone in Cloning Vector, Rat RG80979-U
TMEM55A cDNA ORF Clone, Rat, untagged RG80979-UT
TMEM55A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80979-ACGLN
TMEM55A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80979-ACG
TMEM55A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80979-ANG
TMEM55A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80979-ACR
TMEM55A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80979-ANR
TMEM55A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80979-CF
TMEM55A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80979-NF
TMEM55A cDNA ORF Clone, Rat, C-His tag RG80979-CH
TMEM55A cDNA ORF Clone, Rat, N-His tag RG80979-NH
TMEM55A cDNA ORF Clone, Rat, C-HA tag RG80979-CY
TMEM55A cDNA ORF Clone, Rat, N-HA tag RG80979-NY
TMEM55A cDNA ORF Clone, Rat, C-Myc tag RG80979-CM
TMEM55A cDNA ORF Clone, Rat, N-Myc tag RG80979-NM
TMEM55A qPCR Primer Pairs, Rat RP300943

TMEM55A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM55A cDNA ORF Clone in Cloning Vector, Mouse MG51527-U
TMEM55A cDNA ORF Clone, Mouse, untagged MG51527-UT
TMEM55A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51527-ACG
TMEM55A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51527-ACGLN
TMEM55A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51527-ANG
TMEM55A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51527-ACR
TMEM55A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51527-ANR
TMEM55A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51527-CF
TMEM55A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51527-NF
TMEM55A cDNA ORF Clone, Mouse, C-His tag MG51527-CH
TMEM55A cDNA ORF Clone, Mouse, C-HA tag MG51527-CY
TMEM55A cDNA ORF Clone, Mouse, N-HA tag MG51527-NY
TMEM55A cDNA ORF Clone, Mouse, C-Myc tag MG51527-CM
TMEM55A cDNA ORF Clone, Mouse, N-Myc tag MG51527-NM
TMEM55A qPCR Primer Pairs, Mouse MP201411
info info
添加购物车成功! 添加购物车失败!