TMEM27 cDNA ORF Clone, Mouse, C-His tag

Cat: MG50547-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM27 Reagents
CRO Services
Product recommended

All TMEM27 Reagents
TMEM27 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Mouse transmembrane protein 27 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM27 cDNA ORF Clone, Mouse, C-His tag Alternative Names
0610008J07Rik cDNA ORF Clone, Mouse;NX-17 cDNA ORF Clone, Mouse;NX17 cDNA ORF Clone, Mouse
TMEM27 Background Information

TMEM27 is a membrane protein. It has been proposed as a beta cell mass biomarker since it is cleaved and shed by pancreatic beta cells. Overexpression of TMEM27 leads to increased thymidine incorporation, whereas silencing of Tmem27 using RNAi results in a reduction of cell replication. Furthermore, transgenic mice with increased expression of Tmem27 in pancreatic beta cells exhibit increased beta cell mass. TMEM27 is also important for trafficking amino acid transporters to the apical brush border of proximal tubules.

Full Name
transmembrane protein 27
References
  • Pasquali L, et al. (2009) Collectrin gene screening in Turner syndrome patients with kidney malformation. J Genet. 88(1):105-8.
  • Tosetto E, et al. (2009) Locus heterogeneity of Dent's disease: OCRL1 and TMEM27 genes in patients with no CLCN5 mutations. Pediatr Nephrol. 24(10):1967-73.
  • Singer D, et al. (2011) Collectrin and ACE2 in renal and intestinal amino acid transport. Channels (Austin). 5(5):410-23.
  • TMEM27 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TMEM27 cDNA ORF Clone in Cloning Vector, Mouse MG50547-M
    TMEM27 cDNA ORF Clone, Mouse, untagged MG50547-UT
    TMEM27 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50547-ACG
    TMEM27 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50547-ACGLN
    TMEM27 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50547-ACR
    TMEM27 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50547-CF
    TMEM27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50547-NF
    TMEM27 cDNA ORF Clone, Mouse, N-His tag MG50547-NH
    TMEM27 cDNA ORF Clone, Mouse, C-HA tag MG50547-CY
    TMEM27 cDNA ORF Clone, Mouse, N-HA tag MG50547-NY
    TMEM27 cDNA ORF Clone, Mouse, C-Myc tag MG50547-CM
    TMEM27 cDNA ORF Clone, Mouse, N-Myc tag MG50547-NM
    TMEM27 qPCR Primer Pairs, Mouse MP200539

    TMEM27 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TMEM27 cDNA ORF Clone in Cloning Vector, Human HG13301-G
    TMEM27 cDNA ORF Clone, Human, untagged HG13301-UT
    TMEM27 cDNA ORF Clone, Human, C-GFPSpark® tag HG13301-ACG
    TMEM27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13301-ACGLN
    TMEM27 cDNA ORF Clone, Human, C-OFPSpark® tag HG13301-ACR
    TMEM27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13301-CF
    TMEM27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13301-NF
    TMEM27 cDNA ORF Clone, Human, C-His tag HG13301-CH
    TMEM27 cDNA ORF Clone, Human, N-His tag HG13301-NH
    TMEM27 cDNA ORF Clone, Human, C-HA tag HG13301-CY
    TMEM27 cDNA ORF Clone, Human, N-HA tag HG13301-NY
    TMEM27 cDNA ORF Clone, Human, C-Myc tag HG13301-CM
    TMEM27 cDNA ORF Clone, Human, N-Myc tag HG13301-NM
    TMEM27 qPCR Primer Pairs, Human HP102009
    info info
    添加购物车成功! 添加购物车失败!