TMEM237 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51523-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM237 Reagents
CRO Services
Product recommended

All TMEM237 Reagents
TMEM237 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Mouse transmembrane protein 237 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM237 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI853305 cDNA ORF Clone, Mouse;Als2cr4 cDNA ORF Clone, Mouse;Gm972 cDNA ORF Clone, Mouse
TMEM237 Background Information
Full Name
transmembrane protein 237

TMEM237 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM237 cDNA ORF Clone in Cloning Vector, Mouse MG51523-G
TMEM237 cDNA ORF Clone, Mouse, untagged MG51523-UT
TMEM237 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51523-ACG
TMEM237 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51523-ACGLN
TMEM237 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51523-ANG
TMEM237 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51523-ACR
TMEM237 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51523-ANR
TMEM237 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51523-CF
TMEM237 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51523-NF
TMEM237 cDNA ORF Clone, Mouse, C-His tag MG51523-CH
TMEM237 cDNA ORF Clone, Mouse, N-His tag MG51523-NH
TMEM237 cDNA ORF Clone, Mouse, C-HA tag MG51523-CY
TMEM237 cDNA ORF Clone, Mouse, N-HA tag MG51523-NY
TMEM237 cDNA ORF Clone, Mouse, C-Myc tag MG51523-CM
TMEM237 qPCR Primer Pairs, Mouse MP201407

TMEM237 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM237 cDNA ORF Clone in Cloning Vector, Human HG23307-U
TMEM237 cDNA ORF Clone, Human, untagged HG23307-UT
TMEM237 cDNA ORF Clone, Human, C-GFPSpark® tag HG23307-ACG
TMEM237 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23307-ACGLN
TMEM237 cDNA ORF Clone, Human, N-GFPSpark® tag HG23307-ANG
TMEM237 cDNA ORF Clone, Human, C-OFPSpark® tag HG23307-ACR
TMEM237 cDNA ORF Clone, Human, N-OFPSpark® tag HG23307-ANR
TMEM237 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23307-CF
TMEM237 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23307-NF
TMEM237 cDNA ORF Clone, Human, C-His tag HG23307-CH
TMEM237 cDNA ORF Clone, Human, N-His tag HG23307-NH
TMEM237 cDNA ORF Clone, Human, C-HA tag HG23307-CY
TMEM237 cDNA ORF Clone, Human, N-HA tag HG23307-NY
TMEM237 cDNA ORF Clone, Human, C-Myc tag HG23307-CM
TMEM237 cDNA ORF Clone, Human, N-Myc tag HG23307-NM
info info
添加购物车成功! 添加购物车失败!