TMEM14C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52274-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM14C Reagents
CRO Services
Product recommended

All TMEM14C Reagents
TMEM14C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Mouse transmembrane protein 14C with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM14C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1110021D01Rik cDNA ORF Clone, Mouse;AU020193 cDNA ORF Clone, Mouse;HSPC194 cDNA ORF Clone, Mouse
TMEM14C Background Information
Full Name
transmembrane protein 14C

TMEM14C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM14C cDNA ORF Clone in Cloning Vector, Rat RG81677-G
TMEM14C cDNA ORF Clone, Rat, untagged RG81677-UT
TMEM14C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81677-ACGLN
TMEM14C cDNA ORF Clone, Rat, C-GFPSpark® tag RG81677-ACG
TMEM14C cDNA ORF Clone, Rat, C-OFPSpark® tag RG81677-ACR
TMEM14C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81677-CF
TMEM14C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81677-NF
TMEM14C cDNA ORF Clone, Rat, C-His tag RG81677-CH
TMEM14C cDNA ORF Clone, Rat, N-His tag RG81677-NH
TMEM14C cDNA ORF Clone, Rat, C-HA tag RG81677-CY
TMEM14C cDNA ORF Clone, Rat, N-HA tag RG81677-NY
TMEM14C cDNA ORF Clone, Rat, C-Myc tag RG81677-CM
TMEM14C cDNA ORF Clone, Rat, N-Myc tag RG81677-NM

TMEM14C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM14C cDNA ORF Clone in Cloning Vector, Mouse MG52274-U
TMEM14C cDNA ORF Clone, Mouse, untagged MG52274-UT
TMEM14C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52274-ACG
TMEM14C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52274-ACGLN
TMEM14C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52274-ANG
TMEM14C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52274-ACR
TMEM14C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52274-ANR
TMEM14C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52274-NF
TMEM14C cDNA ORF Clone, Mouse, C-His tag MG52274-CH
TMEM14C cDNA ORF Clone, Mouse, N-His tag MG52274-NH
TMEM14C cDNA ORF Clone, Mouse, C-HA tag MG52274-CY
TMEM14C cDNA ORF Clone, Mouse, N-HA tag MG52274-NY
TMEM14C cDNA ORF Clone, Mouse, C-Myc tag MG52274-CM
TMEM14C cDNA ORF Clone, Mouse, N-Myc tag MG52274-NM
TMEM14C qPCR Primer Pairs, Mouse MP202147
info info
添加购物车成功! 添加购物车失败!