TMEM109 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51793-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM109 Reagents
CRO Services
Product recommended

All TMEM109 Reagents
TMEM109 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Mouse transmembrane protein 109 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM109 cDNA ORF Clone, Mouse, C-His tag Alternative Names
1110006I15Rik cDNA ORF Clone, Mouse;AA958958 cDNA ORF Clone, Mouse;C77652 cDNA ORF Clone, Mouse
TMEM109 Background Information
Full Name
transmembrane protein 109

TMEM109 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM109 cDNA ORF Clone in Cloning Vector, Mouse MG51793-U
TMEM109 cDNA ORF Clone, Mouse, untagged MG51793-UT
TMEM109 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51793-ACG
TMEM109 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51793-ACGLN
TMEM109 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51793-ANG
TMEM109 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51793-ACR
TMEM109 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51793-ANR
TMEM109 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51793-CF
TMEM109 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51793-NF
TMEM109 cDNA ORF Clone, Mouse, N-His tag MG51793-NH
TMEM109 cDNA ORF Clone, Mouse, C-HA tag MG51793-CY
TMEM109 cDNA ORF Clone, Mouse, N-HA tag MG51793-NY
TMEM109 cDNA ORF Clone, Mouse, C-Myc tag MG51793-CM
TMEM109 cDNA ORF Clone, Mouse, N-Myc tag MG51793-NM
TMEM109 qPCR Primer Pairs, Mouse MP201666

TMEM109 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM109 cDNA ORF Clone in Cloning Vector, Human HG25278-U
TMEM109 cDNA ORF Clone, Human, untagged HG25278-UT
TMEM109 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25278-ACGLN
TMEM109 cDNA ORF Clone, Human, C-GFPSpark® tag HG25278-ACG
TMEM109 cDNA ORF Clone, Human, N-GFPSpark® tag HG25278-ANG
TMEM109 cDNA ORF Clone, Human, C-OFPSpark® tag HG25278-ACR
TMEM109 cDNA ORF Clone, Human, N-OFPSpark® tag HG25278-ANR
TMEM109 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25278-CF
TMEM109 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25278-NF
TMEM109 cDNA ORF Clone, Human, C-His tag HG25278-CH
TMEM109 cDNA ORF Clone, Human, N-His tag HG25278-NH
TMEM109 cDNA ORF Clone, Human, C-HA tag HG25278-CY
TMEM109 cDNA ORF Clone, Human, N-HA tag HG25278-NY
TMEM109 cDNA ORF Clone, Human, C-Myc tag HG25278-CM
TMEM109 cDNA ORF Clone, Human, N-Myc tag HG25278-NM
info info
添加购物车成功! 添加购物车失败!