TMED1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52984-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMED1 Reagents
CRO Services
Product recommended

All TMED1 Reagents
TMED1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Mouse transmembrane emp24 domain containing 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMED1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Il1rl1l cDNA ORF Clone, Mouse;Ly84l cDNA ORF Clone, Mouse;St2l cDNA ORF Clone, Mouse
TMED1 Background Information

TMED1 belongs to the EMP24/GP25L family. It contains 1 GOLD domain and is widely expressed. TMED1 binds to its receptor IL1RL1 and results in the activation of DNA binding by nuclear factor NF-kappa-B or transcription from the IL8 promoter and most likely requires other proteins to elicit these activities. Dendritic cells from Peyer's patches (but not from spleen) express TMED1 in response to treatment with LPS. TMED1 may play a role in vesicular protein trafficking, mainly in the early secretory pathway. It may act as a cargo receptor at the lumenal side for incorporation of secretory cargo molecules into transport vesicles and may be involved in vesicle coat formation at the cytoplasmic side.

Full Name
transmembrane emp24 protein transport domain containing 1
References
  • Colland F, et al. (2004) Functional Proteomics Mapping of a Human Signaling Pathway. Genome Res. 14(7):1324-32.
  • Gerhard DS, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • TMED1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TMED1 cDNA ORF Clone in Cloning Vector, Mouse MG52984-G
    TMED1 cDNA ORF Clone, Mouse, untagged MG52984-UT
    TMED1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52984-ACGLN
    TMED1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52984-ACG
    TMED1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52984-ACR
    TMED1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52984-CF
    TMED1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52984-NF
    TMED1 cDNA ORF Clone, Mouse, C-His tag MG52984-CH
    TMED1 cDNA ORF Clone, Mouse, N-His tag MG52984-NH
    TMED1 cDNA ORF Clone, Mouse, C-HA tag MG52984-CY
    TMED1 cDNA ORF Clone, Mouse, N-HA tag MG52984-NY
    TMED1 cDNA ORF Clone, Mouse, N-Myc tag MG52984-NM

    TMED1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TMED1 cDNA ORF Clone in Cloning Vector, Human HG13302-G
    TMED1 cDNA ORF Clone, Human, untagged HG13302-UT
    TMED1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13302-ACG
    TMED1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13302-ACGLN
    TMED1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13302-ACR
    TMED1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13302-CF
    TMED1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13302-NF
    TMED1 cDNA ORF Clone, Human, C-His tag HG13302-CH
    TMED1 cDNA ORF Clone, Human, N-His tag HG13302-NH
    TMED1 cDNA ORF Clone, Human, C-HA tag HG13302-CY
    TMED1 cDNA ORF Clone, Human, N-HA tag HG13302-NY
    TMED1 cDNA ORF Clone, Human, C-Myc tag HG13302-CM
    TMED1 cDNA ORF Clone, Human, N-Myc tag HG13302-NM
    TMED1 qPCR Primer Pairs, Human HP102010
    info info
    添加购物车成功! 添加购物车失败!