TMBIM1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52626-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMBIM1 Reagents
CRO Services
Product recommended

All TMBIM1 Reagents
TMBIM1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Mouse transmembrane BAX inhibitor motif containing 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMBIM1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2310061B02Rik cDNA ORF Clone, Mouse;AA960455 cDNA ORF Clone, Mouse;AU024746 cDNA ORF Clone, Mouse;C78899 cDNA ORF Clone, Mouse;mKIAA4161 cDNA ORF Clone, Mouse;RECS1 cDNA ORF Clone, Mouse;Tmbib1 cDNA ORF Clone, Mouse
TMBIM1 Background Information
Full Name
transmembrane BAX inhibitor motif containing 1

TMBIM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMBIM1 cDNA ORF Clone in Cloning Vector, Mouse MG52626-U
TMBIM1 cDNA ORF Clone, Mouse, untagged MG52626-UT
TMBIM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52626-ACG
TMBIM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52626-ACGLN
TMBIM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52626-ANG
TMBIM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52626-ACR
TMBIM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52626-ANR
TMBIM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52626-CF
TMBIM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52626-NF
TMBIM1 cDNA ORF Clone, Mouse, C-His tag MG52626-CH
TMBIM1 cDNA ORF Clone, Mouse, C-HA tag MG52626-CY
TMBIM1 cDNA ORF Clone, Mouse, N-HA tag MG52626-NY
TMBIM1 cDNA ORF Clone, Mouse, C-Myc tag MG52626-CM
TMBIM1 cDNA ORF Clone, Mouse, N-Myc tag MG52626-NM
TMBIM1 qPCR Primer Pairs, Mouse MP202497

TMBIM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMBIM1 cDNA ORF Clone in Cloning Vector, Human HG22441-U
TMBIM1 cDNA ORF Clone, Human, untagged HG22441-UT
TMBIM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG22441-ACG
TMBIM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22441-ACGLN
TMBIM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG22441-ANG
TMBIM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG22441-ACR
TMBIM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG22441-ANR
TMBIM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22441-CF
TMBIM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22441-NF
TMBIM1 cDNA ORF Clone, Human, C-His tag HG22441-CH
TMBIM1 cDNA ORF Clone, Human, N-His tag HG22441-NH
TMBIM1 cDNA ORF Clone, Human, C-HA tag HG22441-CY
TMBIM1 cDNA ORF Clone, Human, N-HA tag HG22441-NY
TMBIM1 cDNA ORF Clone, Human, C-Myc tag HG22441-CM
TMBIM1 cDNA ORF Clone, Human, N-Myc tag HG22441-NM
info info
添加购物车成功! 添加购物车失败!