TLR6 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50648-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TLR6 Reagents
CRO Services
Product recommended

All TLR6 Reagents
TLR6 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2421 bp
Description
Full length Clone DNA of Mouse toll-like receptor 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR6 Background Information
Full Name
toll like receptor 6

TLR6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TLR6 cDNA ORF Clone in Cloning Vector, Rhesus CG90256-G
TLR6 cDNA ORF Clone, Rhesus, untagged CG90256-UT
TLR6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90256-ACGLN
TLR6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90256-ACG
TLR6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90256-ACR
TLR6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90256-G-F
TLR6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90256-CF
TLR6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90256-NF
TLR6 cDNA ORF Clone, Rhesus, C-His tag CG90256-CH
TLR6 cDNA ORF Clone, Rhesus, N-His tag CG90256-NH
TLR6 cDNA ORF Clone, Rhesus, C-HA tag CG90256-CY
TLR6 cDNA ORF Clone, Rhesus, N-HA tag CG90256-NY
TLR6 cDNA ORF Clone, Rhesus, C-Myc tag CG90256-CM
TLR6 cDNA ORF Clone, Rhesus, N-Myc tag CG90256-NM

TLR6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TLR6 cDNA ORF Clone in Cloning Vector, Rat RG80401-G
TLR6 cDNA ORF Clone, Rat, untagged RG80401-UT
TLR6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80401-ACGLN
TLR6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80401-ACG
TLR6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80401-ACR
TLR6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80401-CF
TLR6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80401-NF
TLR6 cDNA ORF Clone, Rat, C-His tag RG80401-CH
TLR6 cDNA ORF Clone, Rat, N-His tag RG80401-NH
TLR6 cDNA ORF Clone, Rat, C-HA tag RG80401-CY
TLR6 cDNA ORF Clone, Rat, N-HA tag RG80401-NY
TLR6 cDNA ORF Clone, Rat, C-Myc tag RG80401-CM
TLR6 cDNA ORF Clone, Rat, N-Myc tag RG80401-NM
TLR6 qPCR Primer Pairs, Rat RP300366

TLR6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TLR6 cDNA ORF Clone in Cloning Vector, Mouse MG50648-M
TLR6 cDNA ORF Clone, Mouse, untagged MG50648-UT
TLR6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50648-ACG
TLR6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50648-ACGLN
TLR6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50648-ACR
TLR6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50648-CF
TLR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50648-NF
TLR6 cDNA ORF Clone, Mouse, C-His tag MG50648-CH
TLR6 cDNA ORF Clone, Mouse, N-His tag MG50648-NH
TLR6 cDNA ORF Clone, Mouse, C-HA tag MG50648-CY
TLR6 cDNA ORF Clone, Mouse, N-HA tag MG50648-NY
TLR6 cDNA ORF Clone, Mouse, N-Myc tag MG50648-NM
TLR6 qPCR Primer Pairs, Mouse MP200627

TLR6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TLR6 cDNA ORF Clone in Cloning Vector, Human HG11428-M
TLR6 cDNA ORF Clone, Human, untagged HG11428-UT
TLR6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11428-ACG
TLR6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11428-ACGLN
TLR6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11428-ACR
TLR6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11428-CF
TLR6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11428-NF
TLR6 cDNA ORF Clone, Human, C-His tag HG11428-CH
TLR6 cDNA ORF Clone, Human, N-His tag HG11428-NH
TLR6 cDNA ORF Clone, Human, C-HA tag HG11428-CY
TLR6 cDNA ORF Clone, Human, N-HA tag HG11428-NY
TLR6 cDNA ORF Clone, Human, C-Myc tag HG11428-CM
TLR6 cDNA ORF Clone, Human, N-Myc tag HG11428-NM
TLR6 qPCR Primer Pairs, Human HP101305
info info
添加购物车成功! 添加购物车失败!