TLR3 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50161-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TLR3 Reagents
CRO Services
Product recommended

All TLR3 Reagents
TLR3 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2718 bp
Description
Full length Clone DNA of Mouse toll-like receptor 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR3 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI957183 cDNA ORF Clone, Mouse;Tlr3 cDNA ORF Clone, Mouse
TLR3 Background Information

Toll-like receptor 3 (TLR3) also known as CD283 (cluster of differentiation 283) is a member of the Toll-like receptor family of pattern recognition receptors of the innate immune system. TLR3/CD283 plays a fundamental role in pathogen recognition and activation of innate immunity. TLR3 is a nucleotide-sensing TLR which is activated by double-stranded RNA, a sign of viral infection. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
toll like receptor 3
References
  • Muzio M, et al.. (2000) Differential expression and regulation of toll-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cells. J Immunol. 164(11): 5998-6004.
  • Doyle S, et al.. (2002) IRF3 mediates a TLR3/TLR4-specific antiviral gene program. Immunity. 17(3): 251-63.
  • Choe J, et al.. (2005) Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science. 309(5734): 581-5.
  • TLR3 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    TLR3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90259-G

    TLR3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TLR3 cDNA ORF Clone, Rhesus, untagged CG90259-UT
    TLR3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90259-ACG
    TLR3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90259-ACGLN
    TLR3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90259-ACR
    TLR3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90259-CF
    TLR3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90259-NF
    TLR3 cDNA ORF Clone, Rhesus, C-His tag CG90259-CH
    TLR3 cDNA ORF Clone, Rhesus, N-His tag CG90259-NH
    TLR3 cDNA ORF Clone, Rhesus, C-HA tag CG90259-CY
    TLR3 cDNA ORF Clone, Rhesus, N-HA tag CG90259-NY
    TLR3 cDNA ORF Clone, Rhesus, C-Myc tag CG90259-CM
    TLR3 cDNA ORF Clone, Rhesus, N-Myc tag CG90259-NM

    TLR3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TLR3 cDNA ORF Clone in Cloning Vector, Mouse MG50161-M
    TLR3 cDNA ORF Clone, Mouse, untagged MG50161-UT
    TLR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50161-ACG
    TLR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50161-ACGLN
    TLR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50161-ACR
    TLR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50161-CF
    TLR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50161-NF
    TLR3 cDNA ORF Clone, Mouse, C-His tag MG50161-CH
    TLR3 cDNA ORF Clone, Mouse, C-HA tag MG50161-CY
    TLR3 cDNA ORF Clone, Mouse, N-HA tag MG50161-NY
    TLR3 cDNA ORF Clone, Mouse, C-Myc tag MG50161-CM
    TLR3 cDNA ORF Clone, Mouse, N-Myc tag MG50161-NM
    TLR3 qPCR Primer Pairs, Mouse MP200191

    TLR3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TLR3 cDNA ORF Clone in Cloning Vector, Human HG10190-G
    TLR3 cDNA ORF Clone, Human, untagged HG10190-UT
    TLR3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10190-ACGLN
    TLR3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10190-ACG
    TLR3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10190-ANG
    TLR3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10190-ACR
    TLR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10190-CF
    TLR3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10190-NF
    TLR3 cDNA ORF Clone, Human, C-His tag HG10190-CH
    TLR3 cDNA ORF Clone, Human, N-His tag HG10190-NH
    TLR3 cDNA ORF Clone, Human, C-HA tag HG10190-CY
    TLR3 cDNA ORF Clone, Human, N-HA tag HG10190-NY
    TLR3 cDNA ORF Clone, Human, C-Myc tag HG10190-CM
    TLR3 cDNA ORF Clone, Human, N-Myc tag HG10190-NM
    TLR3 qPCR Primer Pairs, Human HP100256
    info info
    添加购物车成功! 添加购物车失败!