TLE1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52563-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TLE1 Reagents
CRO Services
Product recommended

All TLE1 Reagents
TLE1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2310 bp
Description
Full length Clone DNA of Mouse transducin-like enhancer of split 1, homolog of Drosophila E(spl) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLE1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
C230057C06Rik cDNA ORF Clone, Mouse;Estm14 cDNA ORF Clone, Mouse;Grg-1 cDNA ORF Clone, Mouse;Grg1 cDNA ORF Clone, Mouse;Tle4l cDNA ORF Clone, Mouse
TLE1 Background Information
Full Name
transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)

TLE1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TLE1 cDNA ORF Clone in Cloning Vector, Mouse MG52563-G
TLE1 cDNA ORF Clone, Mouse, untagged MG52563-UT
TLE1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52563-ACGLN
TLE1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52563-ACG
TLE1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52563-ANG
TLE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52563-ACR
TLE1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52563-ANR
TLE1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52563-CF
TLE1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52563-NF
TLE1 cDNA ORF Clone, Mouse, C-His tag MG52563-CH
TLE1 cDNA ORF Clone, Mouse, C-HA tag MG52563-CY
TLE1 cDNA ORF Clone, Mouse, N-HA tag MG52563-NY
TLE1 cDNA ORF Clone, Mouse, C-Myc tag MG52563-CM
TLE1 cDNA ORF Clone, Mouse, N-Myc tag MG52563-NM
TLE1 qPCR Primer Pairs, Mouse MP202435

TLE1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TLE1 cDNA ORF Clone in Cloning Vector, Human HG11603-M
TLE1 cDNA ORF Clone, Human, untagged HG11603-UT
TLE1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11603-ACGLN
TLE1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11603-ACG
TLE1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11603-ANG
TLE1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11603-ACR
TLE1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11603-ANR
TLE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11603-CF
TLE1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11603-NF
TLE1 cDNA ORF Clone, Human, C-His tag HG11603-CH
TLE1 cDNA ORF Clone, Human, N-His tag HG11603-NH
TLE1 cDNA ORF Clone, Human, C-HA tag HG11603-CY
TLE1 cDNA ORF Clone, Human, N-HA tag HG11603-NY
TLE1 cDNA ORF Clone, Human, C-Myc tag HG11603-CM
TLE1 cDNA ORF Clone, Human, N-Myc tag HG11603-NM
TLE1 qPCR Primer Pairs, Human HP101464
info info
添加购物车成功! 添加购物车失败!