TIA1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51484-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TIA1 Reagents
CRO Services
Product recommended

All TIA1 Reagents
TIA1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Mouse cytotoxic granule-associated RNA binding protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIA1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2310050N03Rik cDNA ORF Clone, Mouse;AI256674 cDNA ORF Clone, Mouse;mTIA-1 cDNA ORF Clone, Mouse;TIA-1 cDNA ORF Clone, Mouse
TIA1 Background Information
Full Name
TIA1 cytotoxic granule-associated RNA binding protein

TIA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TIA1 cDNA ORF Clone in Cloning Vector, Mouse MG51484-G
TIA1 cDNA ORF Clone, Mouse, untagged MG51484-UT
TIA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51484-ACGLN
TIA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51484-ACG
TIA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51484-ANG
TIA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51484-ACR
TIA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51484-ANR
TIA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51484-CF
TIA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51484-NF
TIA1 cDNA ORF Clone, Mouse, C-His tag MG51484-CH
TIA1 cDNA ORF Clone, Mouse, N-His tag MG51484-NH
TIA1 cDNA ORF Clone, Mouse, C-HA tag MG51484-CY
TIA1 cDNA ORF Clone, Mouse, N-HA tag MG51484-NY
TIA1 cDNA ORF Clone, Mouse, C-Myc tag MG51484-CM
TIA1 qPCR Primer Pairs, Mouse MP201368

TIA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TIA1 cDNA ORF Clone in Cloning Vector, Human HG18574-U
TIA1 cDNA ORF Clone, Human, untagged HG18574-UT
TIA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18574-ACGLN
TIA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18574-ACG
TIA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18574-ANG
TIA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18574-ACR
TIA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18574-ANR
TIA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18574-CF
TIA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18574-NF
TIA1 cDNA ORF Clone, Human, C-His tag HG18574-CH
TIA1 cDNA ORF Clone, Human, N-His tag HG18574-NH
TIA1 cDNA ORF Clone, Human, C-HA tag HG18574-CY
TIA1 cDNA ORF Clone, Human, N-HA tag HG18574-NY
TIA1 cDNA ORF Clone, Human, C-Myc tag HG18574-CM
TIA1 cDNA ORF Clone, Human, N-Myc tag HG18574-NM
info info
添加购物车成功! 添加购物车失败!