THYN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52806-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All THYN1 Reagents
CRO Services
Product recommended

All THYN1 Reagents
THYN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Mouse thymocyte nuclear protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

THYN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
D730042P09Rik cDNA ORF Clone, Mouse;HSPC144 cDNA ORF Clone, Mouse;MDS012 cDNA ORF Clone, Mouse;MY105 cDNA ORF Clone, Mouse;Thy28 cDNA ORF Clone, Mouse
THYN1 Background Information
Full Name
thymocyte nuclear protein 1

THYN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
THYN1 cDNA ORF Clone in Cloning Vector, Rat RG8A0061-U
THYN1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0061-ACGLN

THYN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
THYN1 cDNA ORF Clone in Cloning Vector, Mouse MG52806-G
THYN1 cDNA ORF Clone, Mouse, untagged MG52806-UT
THYN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52806-ACGLN
THYN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52806-ACG
THYN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52806-ACR
THYN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52806-NF
THYN1 cDNA ORF Clone, Mouse, C-His tag MG52806-CH
THYN1 cDNA ORF Clone, Mouse, N-His tag MG52806-NH
THYN1 cDNA ORF Clone, Mouse, C-HA tag MG52806-CY
THYN1 cDNA ORF Clone, Mouse, N-HA tag MG52806-NY
THYN1 cDNA ORF Clone, Mouse, C-Myc tag MG52806-CM
THYN1 cDNA ORF Clone, Mouse, N-Myc tag MG52806-NM

THYN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
THYN1 cDNA ORF Clone in Cloning Vector, Human HG17065-U
THYN1 cDNA ORF Clone, Human, untagged HG17065-UT
THYN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17065-ACGLN
THYN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17065-ACG
THYN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17065-ANG
THYN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17065-ACR
THYN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17065-ANR
THYN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17065-CF
THYN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17065-NF
THYN1 cDNA ORF Clone, Human, C-His tag HG17065-CH
THYN1 cDNA ORF Clone, Human, N-His tag HG17065-NH
THYN1 cDNA ORF Clone, Human, C-HA tag HG17065-CY
THYN1 cDNA ORF Clone, Human, N-HA tag HG17065-NY
THYN1 cDNA ORF Clone, Human, C-Myc tag HG17065-CM
THYN1 cDNA ORF Clone, Human, N-Myc tag HG17065-NM
info info
添加购物车成功! 添加购物车失败!