After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse THSD1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse THSD1 cDNA Clone Product Information
NCBI RefSeq:NM_019576.1
RefSeq ORF Size:2556bp
cDNA Description:Full length Clone DNA of Mus musculus thrombospondin, type I , domain 1.
Gene Synonym:Tmtsp, AW121720, 4833423O18Rik, Thsd1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Thrombospondin type-1 domain-containing protein 1, also known as transmembrane molecule with thrombospondin module, THSD1 and TMTSP, is a single-pass type I membrane protein which contains one TSP type-1 domain. THSD1 is a multi-domain, multi-functional glycoprotein synthesized by many cells. Matricellular THSD1 modulates cell adhesion and proliferation. It is involved in angiogenesis, inflammation, wound healing and cancer. In vitro, nanomolar concentrations of Thrombospondin-1 are required to alter endothelial and vascular smooth muscle cell adhesion, proliferation, motility, and survival. As a major platelet protein, for a long time it was postulated to control hemostasis via platelet aggregate stabilization. THSD1 is a potent angiogenesis inhibitor, and down-regulation of THSD1 has been suggested to alter tumor growth by modulating angiogenesis in a variety of tumor types.

References
  • Lawler J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med. 6(1): 1-12.
  • Ren B, et al. (2006) Regulation of tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta. 1765(2): 178-88.
  • Mirochnik Y, et al. (2008) Thrombospondin and apoptosis: molecular mechanisms and use for design of complementation treatments. Curr Drug Targets. 9(10): 851-62.
  • Bonnefoy A, et al. (2008) The evolving role of thrombospondin-1 in hemostasis and vascular biology. Cell Mol Life Sci. 65(5): 713-27.
  • Isenberg JS, et al. (2008) Thrombospondin-1: a physiological regulator of nitric oxide signaling. Cell Mol Life Sci. 65(5): 728-42.
  • Size / Price
    Catalog: MG50400-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"