Quick Order

Mouse THSD1 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse THSD1 cDNA Clone Product Information
    NCBI RefSeq:NM_019576.1
    RefSeq ORF Size:2556bp
    cDNA Description:Full length Clone DNA of Mus musculus thrombospondin, type I , domain 1 with C terminal Myc tag.
    Gene Synonym:Tmtsp, AW121720, 4833423O18Rik, Thsd1
    Species:Mouse
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with THSD1 qPCR primers for gene expression analysis, MP200073 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Thrombospondin type-1 domain-containing protein 1, also known as transmembrane molecule with thrombospondin module, THSD1 and TMTSP, is a single-pass type I membrane protein which contains one TSP type-1 domain. THSD1 is a multi-domain, multi-functional glycoprotein synthesized by many cells. Matricellular THSD1 modulates cell adhesion and proliferation. It is involved in angiogenesis, inflammation, wound healing and cancer. In vitro, nanomolar concentrations of Thrombospondin-1 are required to alter endothelial and vascular smooth muscle cell adhesion, proliferation, motility, and survival. As a major platelet protein, for a long time it was postulated to control hemostasis via platelet aggregate stabilization. THSD1 is a potent angiogenesis inhibitor, and down-regulation of THSD1 has been suggested to alter tumor growth by modulating angiogenesis in a variety of tumor types.

    References
  • Lawler J. (2002) Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J Cell Mol Med. 6(1): 1-12.
  • Ren B, et al. (2006) Regulation of tumor angiogenesis by thrombospondin-1. Biochim Biophys Acta. 1765(2): 178-88.
  • Mirochnik Y, et al. (2008) Thrombospondin and apoptosis: molecular mechanisms and use for design of complementation treatments. Curr Drug Targets. 9(10): 851-62.
  • Bonnefoy A, et al. (2008) The evolving role of thrombospondin-1 in hemostasis and vascular biology. Cell Mol Life Sci. 65(5): 713-27.
  • Isenberg JS, et al. (2008) Thrombospondin-1: a physiological regulator of nitric oxide signaling. Cell Mol Life Sci. 65(5): 728-42.
  • Size / Price
    Catalog: MG50400-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"