TGFBR3 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50542-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TGFBR3 Reagents
CRO Services
Product recommended

All TGFBR3 Reagents
TGFBR3 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2553 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 405T/C,1209C/T,1488A/T,1525A/C,1779C/T,1821A/G,2175C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse transforming growth factor, beta receptor III with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
HindIII + NotI (6kb + 2.60kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TGFBR3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TGFBR3 cDNA ORF Clone, Mouse, C-Myc tag Validated Images
Human STAT3 Gene Plasmid Map 5650
TGFBR3 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110036H20Rik cDNA ORF Clone, Mouse;AU015626 cDNA ORF Clone, Mouse;AW215636 cDNA ORF Clone, Mouse;TBRIII cDNA ORF Clone, Mouse
TGFBR3 Background Information

Betaglycan also known as transforming growth factor beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate / heparan sulfate proteoglycan. TGFBR3 is a transforming growth factor (TGF)-beta type III receptor. This receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. TGFBR3 is the TGF-β component most commonly downregulated among localized human prostate cancer studies. TGFBR3 knockdown led to focus formation and enhanced expression of CD133, a marker found on prostate cancer stem cells. TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFβ) and inhibin, two members of the TGFβ superfamily of growth factors that regulate many aspects of reproductive biology. TGFBR3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis.

Full Name
transforming growth factor, beta receptor III
References
  • Johnson DW, et al. (1996) Assignment of human transforming growth factor-beta type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively. Genomics. 28 (2): 356-7.
  • Rotzer D, et al. (2001) Type III TGF-beta receptor-independent signalling of TGF-beta2 via T betaRII-B, an alternatively spliced TGF- type II receptor. EMBO J. 20 (3): 480-90.
  • Gao J, et al. (1999) Expression of transforming growth factor-beta receptors types II and III within various cells in the rat periodontium. J Periodont Res. 34 (2): 113-22.
  • TGFBR3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TGFBR3 cDNA ORF Clone in Cloning Vector, Mouse MG50542-M
    TGFBR3 cDNA ORF Clone, Mouse, untagged MG50542-UT
    TGFBR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50542-ACG
    TGFBR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50542-ACGLN
    TGFBR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50542-ACR
    TGFBR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50542-CF
    TGFBR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50542-NF
    TGFBR3 cDNA ORF Clone, Mouse, C-His tag MG50542-CH
    TGFBR3 cDNA ORF Clone, Mouse, N-His tag MG50542-NH
    TGFBR3 cDNA ORF Clone, Mouse, C-HA tag MG50542-CY
    TGFBR3 cDNA ORF Clone, Mouse, N-HA tag MG50542-NY
    TGFBR3 cDNA ORF Clone, Mouse, N-Myc tag MG50542-NM
    TGFBR3 qPCR Primer Pairs, Mouse MP200534

    TGFBR3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TGFBR3 cDNA ORF Clone in Cloning Vector, Human HG10778-M
    TGFBR3 cDNA ORF Clone, Human, untagged HG10778-UT
    TGFBR3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10778-ACG
    TGFBR3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10778-ACGLN
    TGFBR3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10778-ACR
    TGFBR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10778-CF
    TGFBR3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10778-NF
    TGFBR3 cDNA ORF Clone, Human, C-His tag HG10778-CH
    TGFBR3 cDNA ORF Clone, Human, N-His tag HG10778-NH
    TGFBR3 cDNA ORF Clone, Human, C-HA tag HG10778-CY
    TGFBR3 cDNA ORF Clone, Human, N-HA tag HG10778-NY
    TGFBR3 cDNA ORF Clone, Human, C-Myc tag HG10778-CM
    TGFBR3 cDNA ORF Clone, Human, N-Myc tag HG10778-NM
    TGFBR3 qPCR Primer Pairs, Human HP100906
    info info
    添加购物车成功! 添加购物车失败!