Quick Order

Text Size:AAA

Mouse TGFBR3 / Betaglycan Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse TGFBR3 cDNA Clone Product Information
NCBI RefSeq:NM_011578.2
RefSeq ORF Size:2553bp
cDNA Description:Full length Clone DNA of Mus musculus transforming growth factor, beta receptor III with C terminal Myc tag.
Gene Synonym:TBRIII, AU015626, AW215636, 1110036H20Rik, Tgfbr3
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:pCMV3-mTGFBR3-Myc
Restriction Site:HindIII + NotI (6kb + 2.60kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 405T/C,1209C/T,1488A/T,1525A/C,1779C/T,1821A/G,2175C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse TGFBR3 Gene Plasmid Map
Mouse TGFBR3 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Betaglycan also known as transforming growth factor beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate / heparan sulfate proteoglycan. TGFBR3 is a transforming growth factor (TGF)-beta type III receptor. This receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. TGFBR3 is the TGF-β component most commonly downregulated among localized human prostate cancer studies. TGFBR3 knockdown led to focus formation and enhanced expression of CD133, a marker found on prostate cancer stem cells. TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFβ) and inhibin, two members of the TGFβ superfamily of growth factors that regulate many aspects of reproductive biology. TGFBR3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis.

References
  • Johnson DW, et al. (1996) Assignment of human transforming growth factor-beta type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively. Genomics. 28 (2): 356-7.
  • Rotzer D, et al. (2001) Type III TGF-beta receptor-independent signalling of TGF-beta2 via T betaRII-B, an alternatively spliced TGF- type II receptor. EMBO J. 20 (3): 480-90.
  • Gao J, et al. (1999) Expression of transforming growth factor-beta receptors types II and III within various cells in the rat periodontium. J Periodont Res. 34 (2): 113-22.
  • Size / Price
    Catalog: MG50542-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse TGFBR3 ORF mammalian expression plasmid, C-Myc tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"