Text Size:AAA

Mouse TFRC/CD71 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Human DDX3Y Gene Plasmid Map 17935
DatasheetReviewsRelated ProductsProtocols
Mouse TFRC cDNA Clone Product Information
NCBI RefSeq:NM_011638.4
RefSeq ORF Size:2331 bp
cDNA Description:Full length Clone DNA of Mouse transferrin receptor with C terminal Flag tag.
Gene Synonym:TR, TFR, p90, CD71, TFR1, Trfr, Mtvr1, Mtvr-1, AI195355, AI426448, AU015758, 2610028K12Rik, E430033M20Rik, Tfrc
Restriction Site:KpnI + NotI(6kb+2.33kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
( We provide with TFRC qPCR primers for gene expression analysis, MP200716 )
Promoter:Enhanced CMV cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Transferrin receptor protein 1, also known as transferrin receptor, Trfr, p90, CD71 and TFRC, is a single-pass type II membrane protein which belongs to the peptidase M28 family and M28B subfamily. TFRC / CD71 is a membrane-bound protein expressed in larger amounts in proliferating. The specific expression of TFRC can represent a diagnostic tool or a therapeutic target in solid tumours expressing this antigen. Transferrin receptor is necessary for development of erythrocytes and the nervous system. TFRC / CD71 is regulated by cellular iron levels through binding of the iron regulatory proteins, IRP1 and IRP2, to iron-responsive elements in the 3'-UTR. Up-regulated upon mitogenic stimulation. TFRC / CD71 represents a marker of malignant transformation in the pancreas that could be applied as potential diagnostic and therapeutic target.

  • Douabin-Gicquel V., et al., 2001,Hum. Genet. 109:393-401.
  • Ryschich,E. et al., 2004,Eur J Cancer. 40 (9):1418-22.
  • Tosoni D., et al., 2005, Cell 123:875-888.
  • Wollscheid B., et al., 2009, Nat. Biotechnol. 27:378-386.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.