TFF2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50578-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TFF2 Reagents
CRO Services
Product recommended

All TFF2 Reagents
TFF2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
390 bp
Description
Full length Clone DNA of Mouse trefoil factor 2 (spasmolytic protein 1) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TFF2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
mSP cDNA ORF Clone, Mouse;SP cDNA ORF Clone, Mouse
TFF2 Background Information
Full Name
trefoil factor 2

TFF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TFF2 cDNA ORF Clone in Cloning Vector, Mouse MG50578-M
TFF2 cDNA ORF Clone, Mouse, untagged MG50578-UT
TFF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50578-ACGLN
TFF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50578-ACG
TFF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50578-ACR
TFF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50578-CF
TFF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50578-NF
TFF2 cDNA ORF Clone, Mouse, C-His tag MG50578-CH
TFF2 cDNA ORF Clone, Mouse, N-His tag MG50578-NH
TFF2 cDNA ORF Clone, Mouse, N-HA tag MG50578-NY
TFF2 cDNA ORF Clone, Mouse, C-Myc tag MG50578-CM
TFF2 cDNA ORF Clone, Mouse, N-Myc tag MG50578-NM
TFF2 qPCR Primer Pairs, Mouse MP200570

TFF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TFF2 cDNA ORF Clone in Cloning Vector, Human HG13632-G
TFF2 cDNA ORF Clone, Human, untagged HG13632-UT
TFF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13632-ACG
TFF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13632-ACGLN
TFF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13632-ACR
TFF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13632-CF
TFF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13632-NF
TFF2 cDNA ORF Clone, Human, C-His tag HG13632-CH
TFF2 cDNA ORF Clone, Human, N-His tag HG13632-NH
TFF2 cDNA ORF Clone, Human, C-HA tag HG13632-CY
TFF2 cDNA ORF Clone, Human, N-HA tag HG13632-NY
TFF2 cDNA ORF Clone, Human, C-Myc tag HG13632-CM
TFF2 cDNA ORF Clone, Human, N-Myc tag HG13632-NM
TFF2 qPCR Primer Pairs, Human HP102316
info info
添加购物车成功! 添加购物车失败!