DP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52659-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DP1 Reagents
CRO Services
Product recommended

All DP1 Reagents
DP1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Description
Full length Clone DNA of Mouse transcription factor Dp 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Dp1 cDNA ORF Clone, Mouse;Drtf1 cDNA ORF Clone, Mouse
DP1 Background Information
Full Name
transcription factor Dp-1

DP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DP1 cDNA ORF Clone in Cloning Vector, Mouse MG52659-G
DP1 cDNA ORF Clone, Mouse, untagged MG52659-UT
DP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52659-ACGLN
DP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52659-ACG
DP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52659-ANG
DP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52659-ACR
DP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52659-ANR
DP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52659-CF
DP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52659-NF
DP1 cDNA ORF Clone, Mouse, C-His tag MG52659-CH
DP1 cDNA ORF Clone, Mouse, C-HA tag MG52659-CY
DP1 cDNA ORF Clone, Mouse, N-HA tag MG52659-NY
DP1 cDNA ORF Clone, Mouse, C-Myc tag MG52659-CM
DP1 cDNA ORF Clone, Mouse, N-Myc tag MG52659-NM
DP1 qPCR Primer Pairs, Mouse MP202530

DP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DP1 cDNA ORF Clone in Cloning Vector, Human HG17041-U
DP1 cDNA ORF Clone, Human, untagged HG17041-UT
DP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17041-ACG
DP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17041-ACGLN
DP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17041-ANG
DP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17041-ACR
DP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17041-ANR
DP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17041-CF
DP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17041-NF
DP1 cDNA ORF Clone, Human, C-His tag HG17041-CH
DP1 cDNA ORF Clone, Human, N-His tag HG17041-NH
DP1 cDNA ORF Clone, Human, C-HA tag HG17041-CY
DP1 cDNA ORF Clone, Human, N-HA tag HG17041-NY
DP1 cDNA ORF Clone, Human, C-Myc tag HG17041-CM
DP1 cDNA ORF Clone, Human, N-Myc tag HG17041-NM
info info
添加购物车成功! 添加购物车失败!