TFAM cDNA ORF Clone, Mouse, untagged

Cat: MG52535-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TFAM Reagents
CRO Services
Product recommended

All TFAM Reagents
TFAM cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Mouse transcription factor A, mitochondrial.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TFAM cDNA ORF Clone, Mouse, untagged Alternative Names
AI661103 cDNA ORF Clone, Mouse;Hmgts cDNA ORF Clone, Mouse;mtTFA cDNA ORF Clone, Mouse;tsHMG cDNA ORF Clone, Mouse
TFAM Background Information
Full Name
transcription factor A, mitochondrial

TFAM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TFAM cDNA ORF Clone in Cloning Vector, Mouse MG52535-U
TFAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52535-ACGLN
TFAM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52535-ACG
TFAM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52535-ANG
TFAM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52535-ACR
TFAM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52535-ANR
TFAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52535-CF
TFAM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52535-NF
TFAM cDNA ORF Clone, Mouse, C-His tag MG52535-CH
TFAM cDNA ORF Clone, Mouse, N-His tag MG52535-NH
TFAM cDNA ORF Clone, Mouse, C-HA tag MG52535-CY
TFAM cDNA ORF Clone, Mouse, N-HA tag MG52535-NY
TFAM cDNA ORF Clone, Mouse, C-Myc tag MG52535-CM
TFAM cDNA ORF Clone, Mouse, N-Myc tag MG52535-NM
TFAM qPCR Primer Pairs, Mouse MP202408

TFAM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TFAM cDNA ORF Clone in Cloning Vector, Human HG15937-G
TFAM cDNA ORF Clone, Human, untagged HG15937-UT
TFAM cDNA ORF Clone, Human, C-GFPSpark® tag HG15937-ACG
TFAM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15937-ACGLN
TFAM cDNA ORF Clone, Human, N-GFPSpark® tag HG15937-ANG
TFAM cDNA ORF Clone, Human, C-OFPSpark® tag HG15937-ACR
TFAM cDNA ORF Clone, Human, N-OFPSpark® tag HG15937-ANR
TFAM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15937-CF
TFAM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15937-NF
TFAM cDNA ORF Clone, Human, C-His tag HG15937-CH
TFAM cDNA ORF Clone, Human, N-His tag HG15937-NH
TFAM cDNA ORF Clone, Human, C-HA tag HG15937-CY
TFAM cDNA ORF Clone, Human, N-HA tag HG15937-NY
TFAM cDNA ORF Clone, Human, C-Myc tag HG15937-CM
TFAM cDNA ORF Clone, Human, N-Myc tag HG15937-NM
TFAM qPCR Primer Pairs, Human HP104525
info info
添加购物车成功! 添加购物车失败!