TCEAL8 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52064-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TCEAL8 Reagents
CRO Services
Product recommended

All TCEAL8 Reagents
TCEAL8 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Mouse transcription elongation factor A (SII)-like 8 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCEAL8 cDNA ORF Clone, Mouse, N-His tag Alternative Names
3930402F23Rik cDNA ORF Clone, Mouse
TCEAL8 Background Information
Full Name
transcription elongation factor A (SII)-like 8

TCEAL8 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TCEAL8 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90499-G
TCEAL8 cDNA ORF Clone, Cynomolgus, untagged CG90499-UT
TCEAL8 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90499-ACG
TCEAL8 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90499-ANG
TCEAL8 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90499-ACR
TCEAL8 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90499-ANR
TCEAL8 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90499-CF
TCEAL8 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90499-NF
TCEAL8 cDNA ORF Clone, Cynomolgus, C-His tag CG90499-CH
TCEAL8 cDNA ORF Clone, Cynomolgus, N-His tag CG90499-NH
TCEAL8 cDNA ORF Clone, Cynomolgus, C-HA tag CG90499-CY
TCEAL8 cDNA ORF Clone, Cynomolgus, N-HA tag CG90499-NY
TCEAL8 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90499-CM
TCEAL8 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90499-NM

TCEAL8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCEAL8 cDNA ORF Clone in Cloning Vector, Rat RG80551-U
TCEAL8 cDNA ORF Clone, Rat, untagged RG80551-UT
TCEAL8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80551-ACGLN
TCEAL8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80551-ACG
TCEAL8 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80551-ANG
TCEAL8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80551-ACR
TCEAL8 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80551-ANR
TCEAL8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80551-CF
TCEAL8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80551-NF
TCEAL8 cDNA ORF Clone, Rat, C-His tag RG80551-CH
TCEAL8 cDNA ORF Clone, Rat, N-His tag RG80551-NH
TCEAL8 cDNA ORF Clone, Rat, C-HA tag RG80551-CY
TCEAL8 cDNA ORF Clone, Rat, N-HA tag RG80551-NY
TCEAL8 cDNA ORF Clone, Rat, C-Myc tag RG80551-CM
TCEAL8 cDNA ORF Clone, Rat, N-Myc tag RG80551-NM
TCEAL8 qPCR Primer Pairs, Rat RP300515

TCEAL8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCEAL8 cDNA ORF Clone in Cloning Vector, Mouse MG52064-G
TCEAL8 cDNA ORF Clone, Mouse, untagged MG52064-UT
TCEAL8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52064-ACG
TCEAL8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52064-ACGLN
TCEAL8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52064-ANG
TCEAL8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52064-ACR
TCEAL8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52064-ANR
TCEAL8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52064-CF
TCEAL8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52064-NF
TCEAL8 cDNA ORF Clone, Mouse, C-His tag MG52064-CH
TCEAL8 cDNA ORF Clone, Mouse, C-HA tag MG52064-CY
TCEAL8 cDNA ORF Clone, Mouse, N-HA tag MG52064-NY
TCEAL8 cDNA ORF Clone, Mouse, C-Myc tag MG52064-CM
TCEAL8 cDNA ORF Clone, Mouse, N-Myc tag MG52064-NM
TCEAL8 qPCR Primer Pairs, Mouse MP201937

TCEAL8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCEAL8 cDNA ORF Clone in Cloning Vector, Human HG16684-U
TCEAL8 cDNA ORF Clone, Human, untagged HG16684-UT
TCEAL8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16684-ACGLN
TCEAL8 cDNA ORF Clone, Human, C-GFPSpark® tag HG16684-ACG
TCEAL8 cDNA ORF Clone, Human, N-GFPSpark® tag HG16684-ANG
TCEAL8 cDNA ORF Clone, Human, C-OFPSpark® tag HG16684-ACR
TCEAL8 cDNA ORF Clone, Human, N-OFPSpark® tag HG16684-ANR
TCEAL8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16684-CF
TCEAL8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16684-NF
TCEAL8 cDNA ORF Clone, Human, C-His tag HG16684-CH
TCEAL8 cDNA ORF Clone, Human, N-His tag HG16684-NH
TCEAL8 cDNA ORF Clone, Human, C-HA tag HG16684-CY
TCEAL8 cDNA ORF Clone, Human, N-HA tag HG16684-NY
TCEAL8 cDNA ORF Clone, Human, C-Myc tag HG16684-CM
TCEAL8 cDNA ORF Clone, Human, N-Myc tag HG16684-NM
info info
添加购物车成功! 添加购物车失败!