TCEA1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52079-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TCEA1 Reagents
CRO Services
Product recommended

All TCEA1 Reagents
TCEA1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Mouse transcription elongation factor A (SII) 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCEA1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
S-II cDNA ORF Clone, Mouse
TCEA1 Background Information
Full Name
transcription elongation factor A (SII), 1

TCEA1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TCEA1 cDNA ORF Clone in Cloning Vector, Rhesus CG90779-G
TCEA1 cDNA ORF Clone, Rhesus, untagged CG90779-UT
TCEA1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90779-ACG
TCEA1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90779-ACGLN
TCEA1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90779-ANG
TCEA1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90779-ACR
TCEA1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90779-ANR
TCEA1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90779-CF
TCEA1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90779-NF
TCEA1 cDNA ORF Clone, Rhesus, C-His tag CG90779-CH
TCEA1 cDNA ORF Clone, Rhesus, N-His tag CG90779-NH
TCEA1 cDNA ORF Clone, Rhesus, C-HA tag CG90779-CY
TCEA1 cDNA ORF Clone, Rhesus, N-HA tag CG90779-NY
TCEA1 cDNA ORF Clone, Rhesus, C-Myc tag CG90779-CM
TCEA1 cDNA ORF Clone, Rhesus, N-Myc tag CG90779-NM

TCEA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCEA1 cDNA ORF Clone in Cloning Vector, Rat RG87361-U
TCEA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87361-ACGLN

TCEA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCEA1 cDNA ORF Clone in Cloning Vector, Mouse MG52079-G
TCEA1 cDNA ORF Clone, Mouse, untagged MG52079-UT
TCEA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52079-ACGLN
TCEA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52079-ACG
TCEA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52079-ANG
TCEA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52079-ACR
TCEA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52079-ANR
TCEA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52079-CF
TCEA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52079-NF
TCEA1 cDNA ORF Clone, Mouse, C-His tag MG52079-CH
TCEA1 cDNA ORF Clone, Mouse, N-His tag MG52079-NH
TCEA1 cDNA ORF Clone, Mouse, C-HA tag MG52079-CY
TCEA1 cDNA ORF Clone, Mouse, C-Myc tag MG52079-CM
TCEA1 cDNA ORF Clone, Mouse, N-Myc tag MG52079-NM
TCEA1 qPCR Primer Pairs, Mouse MP201952

TCEA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCEA1 cDNA ORF Clone in Cloning Vector, Human HG16717-U
TCEA1 cDNA ORF Clone, Human, untagged HG16717-UT
TCEA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16717-ACG
TCEA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16717-ACGLN
TCEA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16717-ANG
TCEA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16717-ACR
TCEA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16717-ANR
TCEA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16717-CF
TCEA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16717-NF
TCEA1 cDNA ORF Clone, Human, C-His tag HG16717-CH
TCEA1 cDNA ORF Clone, Human, N-His tag HG16717-NH
TCEA1 cDNA ORF Clone, Human, C-HA tag HG16717-CY
TCEA1 cDNA ORF Clone, Human, N-HA tag HG16717-NY
TCEA1 cDNA ORF Clone, Human, C-Myc tag HG16717-CM
TCEA1 cDNA ORF Clone, Human, N-Myc tag HG16717-NM
info info
添加购物车成功! 添加购物车失败!