TAZ cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51785-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TAZ Reagents
CRO Services
Product recommended

All TAZ Reagents
TAZ cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Mouse tafazzin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAZ cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
5031411C02Rik cDNA ORF Clone, Mouse;9130012G04Rik cDNA ORF Clone, Mouse;AW107266 cDNA ORF Clone, Mouse;AW552613 cDNA ORF Clone, Mouse;G4.5 cDNA ORF Clone, Mouse
TAZ Background Information
Full Name
tafazzin

TAZ cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TAZ cDNA ORF Clone in Cloning Vector, Mouse MG51785-G
TAZ cDNA ORF Clone, Mouse, untagged MG51785-UT
TAZ cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51785-ACG
TAZ Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51785-ACGLN
TAZ cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51785-ANG
TAZ cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51785-ACR
TAZ cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51785-ANR
TAZ cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51785-CF
TAZ cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51785-NF
TAZ cDNA ORF Clone, Mouse, C-His tag MG51785-CH
TAZ cDNA ORF Clone, Mouse, N-His tag MG51785-NH
TAZ cDNA ORF Clone, Mouse, C-HA tag MG51785-CY
TAZ cDNA ORF Clone, Mouse, N-HA tag MG51785-NY
TAZ cDNA ORF Clone, Mouse, N-Myc tag MG51785-NM
TAZ qPCR Primer Pairs, Mouse MP201658

TAZ cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAZ cDNA ORF Clone in Cloning Vector, Human HG12274-G
TAZ cDNA ORF Clone, Human, untagged HG12274-UT
TAZ cDNA ORF Clone, Human, C-GFPSpark® tag HG12274-ACG
TAZ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12274-ACGLN
TAZ cDNA ORF Clone, Human, C-OFPSpark® tag HG12274-ACR
TAZ cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12274-CF
TAZ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12274-NF
TAZ cDNA ORF Clone, Human, C-His tag HG12274-CH
TAZ cDNA ORF Clone, Human, N-His tag HG12274-NH
TAZ cDNA ORF Clone, Human, C-HA tag HG12274-CY
TAZ cDNA ORF Clone, Human, N-HA tag HG12274-NY
TAZ cDNA ORF Clone, Human, C-Myc tag HG12274-CM
TAZ cDNA ORF Clone, Human, N-Myc tag HG12274-NM
TAZ qPCR Primer Pairs, Human HP101885
info info
添加购物车成功! 添加购物车失败!