TAGLN3 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52951-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TAGLN3 Reagents
CRO Services
Product recommended

All TAGLN3 Reagents
TAGLN3 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Mouse transgelin 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAGLN3 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
2700038H05Rik cDNA ORF Clone, Mouse;2900005O10Rik cDNA ORF Clone, Mouse;AI426007 cDNA ORF Clone, Mouse;Np25 cDNA ORF Clone, Mouse
TAGLN3 Background Information
Full Name
transgelin 3

TAGLN3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TAGLN3 cDNA ORF Clone in Cloning Vector, Rhesus CG90681-G
TAGLN3 cDNA ORF Clone, Rhesus, untagged CG90681-UT
TAGLN3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90681-ACGLN
TAGLN3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90681-ACG
TAGLN3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90681-ANG
TAGLN3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90681-ACR
TAGLN3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90681-ANR
TAGLN3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90681-CF
TAGLN3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90681-NF
TAGLN3 cDNA ORF Clone, Rhesus, C-His tag CG90681-CH
TAGLN3 cDNA ORF Clone, Rhesus, N-His tag CG90681-NH
TAGLN3 cDNA ORF Clone, Rhesus, C-HA tag CG90681-CY
TAGLN3 cDNA ORF Clone, Rhesus, N-HA tag CG90681-NY
TAGLN3 cDNA ORF Clone, Rhesus, C-Myc tag CG90681-CM
TAGLN3 cDNA ORF Clone, Rhesus, N-Myc tag CG90681-NM

TAGLN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TAGLN3 cDNA ORF Clone in Cloning Vector, Mouse MG52951-G
TAGLN3 cDNA ORF Clone, Mouse, untagged MG52951-UT
TAGLN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52951-ACGLN
TAGLN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52951-ACG
TAGLN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52951-ANG
TAGLN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52951-ACR
TAGLN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52951-ANR
TAGLN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52951-CF
TAGLN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52951-NF
TAGLN3 cDNA ORF Clone, Mouse, C-His tag MG52951-CH
TAGLN3 cDNA ORF Clone, Mouse, N-His tag MG52951-NH
TAGLN3 cDNA ORF Clone, Mouse, C-HA tag MG52951-CY
TAGLN3 cDNA ORF Clone, Mouse, C-Myc tag MG52951-CM
TAGLN3 cDNA ORF Clone, Mouse, N-Myc tag MG52951-NM

TAGLN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAGLN3 cDNA ORF Clone in Cloning Vector, Human HG14590-G
TAGLN3 cDNA ORF Clone, Human, untagged HG14590-UT
TAGLN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14590-ACG
TAGLN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14590-ACGLN
TAGLN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14590-ANG
TAGLN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14590-ACR
TAGLN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14590-ANR
TAGLN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14590-CF
TAGLN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14590-NF
TAGLN3 cDNA ORF Clone, Human, C-His tag HG14590-CH
TAGLN3 cDNA ORF Clone, Human, N-His tag HG14590-NH
TAGLN3 cDNA ORF Clone, Human, C-HA tag HG14590-CY
TAGLN3 cDNA ORF Clone, Human, N-HA tag HG14590-NY
TAGLN3 cDNA ORF Clone, Human, C-Myc tag HG14590-CM
TAGLN3 cDNA ORF Clone, Human, N-Myc tag HG14590-NM
TAGLN3 qPCR Primer Pairs, Human HP103224
info info
添加购物车成功! 添加购物车失败!