Quick Order

Mouse TROP-2/TACSTD2/TACD2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse TACSTD2 cDNA Clone Product Information
    NCBI RefSeq:NM_020047.3
    RefSeq ORF Size:954bp
    cDNA Description:Full length Clone DNA of Mus musculus tumor-associated calcium signal transducer 2 with N terminal Myc tag.
    Gene Synonym:Ly97, EGP-1, TROP2, C80403, GA733-1, MGC141612, MGC141613, Tacstd2
    Species:Mouse
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TACSTD2 qPCR primers for gene expression analysis, MP200891 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    TROP-2, also referred to as tumor associated calcium signal transducer 2 (TACSTD2), GA733-1 or M1S1, is a cell surface glycoprotein highly expressed in a wide variety of epithelial cancers. In contrast, there is little or no expression of Trop-2 in adult somatic tissue. Because it is a cell surface protein that is selectively expressed in tumor cells, Trop-2 is a potential therapeutic target. The cytoplasmic tail of Trop-2 possesses potential serine and tyrosine phosphorylation sites and a phosphatidyl-inositol binding consensus sequence. Trop-2 transduces an intracellular calcium signal, are consistent with the hypothesis that it acts as a cell surface receptor and support a search for a physiological ligand. TROP2 encoding by an intronless gene was originally defined by the monoclonal antibody GA733, and is a member of a family of at least two type I membrane proteins. The other known member is GA733-2, also called EpCAM and TROP1. It has been suggested by studies that the GA733-1 gene was formed by the retroposition of the GA733-2 gene via an mRNA intermediate.

    References
  • Ripani E, et al. (1998) Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 76(5): 671-6.
  • Wang J, et al. (2008) Identification of Trop-2 as an oncogene and an attractive therapeutic target in colon cancers. Mol Cancer Ther. 7(2): 280-5.
  • Size / Price
    Catalog: MG50922-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"