Text Size:AAA

Mouse Smad3 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse SMAD3 cDNA Clone Product Information
    NCBI RefSeq:NM_016769.4
    RefSeq ORF Size:1278bp
    cDNA Description:Full length Clone DNA of Mus musculus MAD homolog 3 (Drosophila).
    Gene Synonym:Madh3, AU022421, Smad3
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:pCMV3-mSMAD3
    Restriction Site:KpnI + XbaI (6.1kb + 1.28kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with Smad3 qPCR primers for gene expression analysis, MP200957 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    SMAD3 belongs to the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD3 is involved in cell signalling. It modulates signals of activin and TGFβ's. Binding of SMAD3 with SMAD4 enables its transmigration into the nucleus where it forms complexes with other proteins and acts as a transcription factor. SMAD3 is a receptor-regulated SMAD (R-SMAD). In mice, mutation of SMAD3 has been linked to colorectal adenocarcinoma, increased systemic inflammation, and accelerated wound healing. Increased SMAD3 activity has been implicated in the pathogenesis of scleroderma. Smad3 is also a multifaceted regulator in adipose physiology and the pathogenesis of obesity and type 2 diabetes.

    References
  • Tan. et al., 2011, Diabetes. 60 (2): 464-76.
  • Yang X. et al., 1999, Nat Cell Biol. 1 (5): 260-6.
  • Zhu Y. et al., 1998, Cell. 94 (6): 703-14.
  • Feng X. et al., 1996, Nature. 383 (6596): 168-72.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"