Smad1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50859-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Smad1 Reagents
CRO Services
Product recommended

All Smad1 Reagents
Smad1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse MAD homolog 1 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI528653 cDNA ORF Clone, Mouse;Madh1 cDNA ORF Clone, Mouse;Madr1 cDNA ORF Clone, Mouse;Mlp1 cDNA ORF Clone, Mouse;MusMLP cDNA ORF Clone, Mouse
Smad1 Background Information
Full Name
SMAD family member 1

Smad1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Smad1 cDNA ORF Clone in Cloning Vector, Mouse MG50859-G
Smad1 cDNA ORF Clone, Mouse, untagged MG50859-UT
Smad1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50859-ACG
Smad1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50859-ACGLN
Smad1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50859-ANG
Smad1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50859-ACR
Smad1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50859-ANR
Smad1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50859-CF
Smad1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50859-NF
Smad1 cDNA ORF Clone, Mouse, C-His tag MG50859-CH
Smad1 cDNA ORF Clone, Mouse, C-HA tag MG50859-CY
Smad1 cDNA ORF Clone, Mouse, N-HA tag MG50859-NY
Smad1 cDNA ORF Clone, Mouse, C-Myc tag MG50859-CM
Smad1 cDNA ORF Clone, Mouse, N-Myc tag MG50859-NM
Smad1 qPCR Primer Pairs, Mouse MP200830

Smad1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Smad1 cDNA ORF Clone in Cloning Vector, Human HG10715-M
Smad1 cDNA ORF Clone, Human, untagged HG10715-UT
Smad1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10715-ACG
Smad1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10715-ACGLN
Smad1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10715-ANG
Smad1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10715-ACR
Smad1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10715-ANR
Smad1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10715-CF
Smad1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10715-NF
Smad1 cDNA ORF Clone, Human, C-His tag HG10715-CH
Smad1 cDNA ORF Clone, Human, N-His tag HG10715-NH
Smad1 cDNA ORF Clone, Human, C-HA tag HG10715-CY
Smad1 cDNA ORF Clone, Human, N-HA tag HG10715-NY
Smad1 cDNA ORF Clone, Human, C-Myc tag HG10715-CM
Smad1 cDNA ORF Clone, Human, N-Myc tag HG10715-NM
Smad1 qPCR Primer Pairs, Human HP100656
info info
添加购物车成功! 添加购物车失败!