SYAP1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51803-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SYAP1 Reagents
CRO Services
Product recommended

All SYAP1 Reagents
SYAP1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Description
Full length Clone DNA of Mouse synapse associated protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SYAP1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
2010110O17Rik cDNA ORF Clone, Mouse;AW011796 cDNA ORF Clone, Mouse
SYAP1 Background Information
Full Name
synapse associated protein 1

SYAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SYAP1 cDNA ORF Clone in Cloning Vector, Rat RG8A1495-U
SYAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1495-ACGLN

SYAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SYAP1 cDNA ORF Clone in Cloning Vector, Mouse MG51803-G
SYAP1 cDNA ORF Clone, Mouse, untagged MG51803-UT
SYAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51803-ACGLN
SYAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51803-ACG
SYAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51803-ANG
SYAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51803-ACR
SYAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51803-ANR
SYAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51803-CF
SYAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51803-NF
SYAP1 cDNA ORF Clone, Mouse, C-His tag MG51803-CH
SYAP1 cDNA ORF Clone, Mouse, N-His tag MG51803-NH
SYAP1 cDNA ORF Clone, Mouse, N-HA tag MG51803-NY
SYAP1 cDNA ORF Clone, Mouse, C-Myc tag MG51803-CM
SYAP1 cDNA ORF Clone, Mouse, N-Myc tag MG51803-NM
SYAP1 qPCR Primer Pairs, Mouse MP201676

SYAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SYAP1 cDNA ORF Clone in Cloning Vector, Human HG16839-U
SYAP1 cDNA ORF Clone, Human, untagged HG16839-UT
SYAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16839-ACG
SYAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16839-ACGLN
SYAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16839-ANG
SYAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16839-ACR
SYAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16839-ANR
SYAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16839-CF
SYAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16839-NF
SYAP1 cDNA ORF Clone, Human, C-His tag HG16839-CH
SYAP1 cDNA ORF Clone, Human, N-His tag HG16839-NH
SYAP1 cDNA ORF Clone, Human, C-HA tag HG16839-CY
SYAP1 cDNA ORF Clone, Human, N-HA tag HG16839-NY
SYAP1 cDNA ORF Clone, Human, C-Myc tag HG16839-CM
SYAP1 cDNA ORF Clone, Human, N-Myc tag HG16839-NM
info info
添加购物车成功! 添加购物车失败!