SUV39H1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG53024-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SUV39H1 Reagents
CRO Services
Product recommended

All SUV39H1 Reagents
SUV39H1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Mouse suppressor of variegation 3-9 homolog 1 (Drosophila) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SUV39H1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI852103 cDNA ORF Clone, Mouse;AL022883 cDNA ORF Clone, Mouse;DXHXS7466e cDNA ORF Clone, Mouse;H3-K9-HMTase1 cDNA ORF Clone, Mouse;KMT1A cDNA ORF Clone, Mouse;mIS6 cDNA ORF Clone, Mouse
SUV39H1 Background Information
Full Name
suppressor of variegation 3-9 homolog 1 (Drosophila)

SUV39H1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SUV39H1 cDNA ORF Clone in Cloning Vector, Rat RG84952-U

SUV39H1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SUV39H1 cDNA ORF Clone in Cloning Vector, Mouse MG53024-G
SUV39H1 cDNA ORF Clone, Mouse, untagged MG53024-UT
SUV39H1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53024-ACGLN
SUV39H1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53024-ACG
SUV39H1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53024-ANG
SUV39H1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53024-ACR
SUV39H1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53024-ANR
SUV39H1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53024-CF
SUV39H1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53024-NF
SUV39H1 cDNA ORF Clone, Mouse, C-His tag MG53024-CH
SUV39H1 cDNA ORF Clone, Mouse, C-HA tag MG53024-CY
SUV39H1 cDNA ORF Clone, Mouse, N-HA tag MG53024-NY
SUV39H1 cDNA ORF Clone, Mouse, C-Myc tag MG53024-CM
SUV39H1 cDNA ORF Clone, Mouse, N-Myc tag MG53024-NM

SUV39H1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SUV39H1 cDNA ORF Clone in Cloning Vector, Human HG11498-M
SUV39H1 cDNA ORF Clone, Human, untagged HG11498-UT
SUV39H1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11498-ACG
SUV39H1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11498-ACGLN
SUV39H1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11498-ANG
SUV39H1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11498-ACR
SUV39H1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11498-ANR
SUV39H1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11498-CF
SUV39H1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11498-NF
SUV39H1 cDNA ORF Clone, Human, C-His tag HG11498-CH
SUV39H1 cDNA ORF Clone, Human, N-His tag HG11498-NH
SUV39H1 cDNA ORF Clone, Human, C-HA tag HG11498-CY
SUV39H1 cDNA ORF Clone, Human, N-HA tag HG11498-NY
SUV39H1 cDNA ORF Clone, Human, C-Myc tag HG11498-CM
SUV39H1 cDNA ORF Clone, Human, N-Myc tag HG11498-NM
SUV39H1 qPCR Primer Pairs, Human HP101374
info info
添加购物车成功! 添加购物车失败!