Sumo 3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52692-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Sumo 3 Reagents
CRO Services
Product recommended

All Sumo 3 Reagents
Sumo 3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Mouse SMT3 suppressor of mif two 3 homolog 3 (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Sumo 3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2810014B19Rik cDNA ORF Clone, Mouse;D10Ertd345e cDNA ORF Clone, Mouse;SMT3A cDNA ORF Clone, Mouse;Smt3h1 cDNA ORF Clone, Mouse;SUMO-3 cDNA ORF Clone, Mouse
Sumo 3 Background Information
Full Name
small ubiquitin-like modifier 3

Sumo 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Sumo 3 cDNA ORF Clone in Cloning Vector, Mouse MG52692-G
Sumo 3 cDNA ORF Clone, Mouse, untagged MG52692-UT
Sumo 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52692-ACG
Sumo 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52692-ACGLN
Sumo 3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52692-ANG
Sumo 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52692-ACR
Sumo 3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52692-ANR
Sumo 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52692-CF
Sumo 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52692-NF
Sumo 3 cDNA ORF Clone, Mouse, C-His tag MG52692-CH
Sumo 3 cDNA ORF Clone, Mouse, N-His tag MG52692-NH
Sumo 3 cDNA ORF Clone, Mouse, C-HA tag MG52692-CY
Sumo 3 cDNA ORF Clone, Mouse, N-HA tag MG52692-NY
Sumo 3 cDNA ORF Clone, Mouse, C-Myc tag MG52692-CM
Sumo 3 qPCR Primer Pairs, Mouse MP202563

Sumo 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Sumo 3 cDNA ORF Clone in Cloning Vector, Human HG12782-U
Sumo 3 cDNA ORF Clone, Human, untagged HG12782-UT
Sumo 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12782-ACG
Sumo 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12782-ACGLN
Sumo 3 cDNA ORF Clone, Human, N-GFPSpark® tag HG12782-ANG
Sumo 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12782-ACR
Sumo 3 cDNA ORF Clone, Human, N-OFPSpark® tag HG12782-ANR
Sumo 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12782-CF
Sumo 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12782-NF
Sumo 3 cDNA ORF Clone, Human, C-His tag HG12782-CH
Sumo 3 cDNA ORF Clone, Human, N-His tag HG12782-NH
Sumo 3 cDNA ORF Clone, Human, C-HA tag HG12782-CY
Sumo 3 cDNA ORF Clone, Human, N-HA tag HG12782-NY
Sumo 3 cDNA ORF Clone, Human, C-Myc tag HG12782-CM
Sumo 3 cDNA ORF Clone, Human, N-Myc tag HG12782-NM
info info
添加购物车成功! 添加购物车失败!