STX12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52115-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STX12 Reagents
CRO Services
Product recommended

All STX12 Reagents
STX12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Mouse syntaxin 12 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STX12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AI850350 cDNA ORF Clone, Mouse;AU041521 cDNA ORF Clone, Mouse;Stx13 cDNA ORF Clone, Mouse
STX12 Background Information
Full Name
syntaxin 12

STX12 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STX12 cDNA ORF Clone in Cloning Vector, Rat RG81217-U
STX12 cDNA ORF Clone, Rat, untagged RG81217-UT
STX12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81217-ACGLN
STX12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81217-ACG
STX12 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81217-ANG
STX12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81217-ACR
STX12 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81217-ANR
STX12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81217-CF
STX12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81217-NF
STX12 cDNA ORF Clone, Rat, C-His tag RG81217-CH
STX12 cDNA ORF Clone, Rat, N-His tag RG81217-NH
STX12 cDNA ORF Clone, Rat, C-HA tag RG81217-CY
STX12 cDNA ORF Clone, Rat, N-HA tag RG81217-NY
STX12 cDNA ORF Clone, Rat, C-Myc tag RG81217-CM
STX12 cDNA ORF Clone, Rat, N-Myc tag RG81217-NM
STX12 qPCR Primer Pairs, Rat RP301173

STX12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STX12 cDNA ORF Clone in Cloning Vector, Mouse MG52115-G
STX12 cDNA ORF Clone, Mouse, untagged MG52115-UT
STX12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52115-ACGLN
STX12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52115-ACG
STX12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52115-ANG
STX12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52115-ACR
STX12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52115-ANR
STX12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52115-CF
STX12 cDNA ORF Clone, Mouse, C-His tag MG52115-CH
STX12 cDNA ORF Clone, Mouse, N-His tag MG52115-NH
STX12 cDNA ORF Clone, Mouse, C-HA tag MG52115-CY
STX12 cDNA ORF Clone, Mouse, N-HA tag MG52115-NY
STX12 cDNA ORF Clone, Mouse, C-Myc tag MG52115-CM
STX12 cDNA ORF Clone, Mouse, N-Myc tag MG52115-NM
STX12 qPCR Primer Pairs, Mouse MP201988

STX12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STX12 cDNA ORF Clone in Cloning Vector, Human HG21149-U
STX12 cDNA ORF Clone, Human, untagged HG21149-UT
STX12 cDNA ORF Clone, Human, C-GFPSpark® tag HG21149-ACG
STX12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21149-ACGLN
STX12 cDNA ORF Clone, Human, N-GFPSpark® tag HG21149-ANG
STX12 cDNA ORF Clone, Human, C-OFPSpark® tag HG21149-ACR
STX12 cDNA ORF Clone, Human, N-OFPSpark® tag HG21149-ANR
STX12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21149-CF
STX12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21149-NF
STX12 cDNA ORF Clone, Human, C-His tag HG21149-CH
STX12 cDNA ORF Clone, Human, N-His tag HG21149-NH
STX12 cDNA ORF Clone, Human, C-HA tag HG21149-CY
STX12 cDNA ORF Clone, Human, N-HA tag HG21149-NY
STX12 cDNA ORF Clone, Human, C-Myc tag HG21149-CM
STX12 cDNA ORF Clone, Human, N-Myc tag HG21149-NM
info info
添加购物车成功! 添加购物车失败!