STRAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51926-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STRAP Reagents
CRO Services
Product recommended

All STRAP Reagents
STRAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Mouse serine/threonine kinase receptor associated protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STRAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AW557906 cDNA ORF Clone, Mouse;C78091 cDNA ORF Clone, Mouse;C79202 cDNA ORF Clone, Mouse;Unrip cDNA ORF Clone, Mouse
STRAP Background Information
Full Name
serine/threonine kinase receptor associated protein

STRAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STRAP cDNA ORF Clone in Cloning Vector, Mouse MG51926-G
STRAP cDNA ORF Clone, Mouse, untagged MG51926-UT
STRAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51926-ACGLN
STRAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51926-ACG
STRAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51926-ANG
STRAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51926-ACR
STRAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51926-ANR
STRAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51926-CF
STRAP cDNA ORF Clone, Mouse, C-His tag MG51926-CH
STRAP cDNA ORF Clone, Mouse, N-His tag MG51926-NH
STRAP cDNA ORF Clone, Mouse, C-HA tag MG51926-CY
STRAP cDNA ORF Clone, Mouse, N-HA tag MG51926-NY
STRAP cDNA ORF Clone, Mouse, C-Myc tag MG51926-CM
STRAP cDNA ORF Clone, Mouse, N-Myc tag MG51926-NM
STRAP qPCR Primer Pairs, Mouse MP201799

STRAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STRAP cDNA ORF Clone in Cloning Vector, Human HG14218-G
STRAP cDNA ORF Clone, Human, untagged HG14218-UT
STRAP cDNA ORF Clone, Human, C-GFPSpark® tag HG14218-ACG
STRAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14218-ACGLN
STRAP cDNA ORF Clone, Human, N-GFPSpark® tag HG14218-ANG
STRAP cDNA ORF Clone, Human, C-OFPSpark® tag HG14218-ACR
STRAP cDNA ORF Clone, Human, N-OFPSpark® tag HG14218-ANR
STRAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14218-CF
STRAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14218-NF
STRAP cDNA ORF Clone, Human, C-His tag HG14218-CH
STRAP cDNA ORF Clone, Human, N-His tag HG14218-NH
STRAP cDNA ORF Clone, Human, C-HA tag HG14218-CY
STRAP cDNA ORF Clone, Human, N-HA tag HG14218-NY
STRAP cDNA ORF Clone, Human, C-Myc tag HG14218-CM
STRAP cDNA ORF Clone, Human, N-Myc tag HG14218-NM
STRAP qPCR Primer Pairs, Human HP102868
info info
添加购物车成功! 添加购物车失败!