STMN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52287-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STMN4 Reagents
CRO Services
Product recommended

All STMN4 Reagents
STMN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Mouse stathmin-like 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STMN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Lagl cDNA ORF Clone, Mouse;R75359 cDNA ORF Clone, Mouse;RB3 cDNA ORF Clone, Mouse
STMN4 Background Information
Full Name
stathmin-like 4

STMN4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STMN4 cDNA ORF Clone in Cloning Vector, Rat RG81355-G

STMN4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STMN4 cDNA ORF Clone in Cloning Vector, Mouse MG52287-G
STMN4 cDNA ORF Clone, Mouse, untagged MG52287-UT
STMN4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52287-ACGLN
STMN4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52287-ACG
STMN4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52287-ANG
STMN4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52287-ACR
STMN4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52287-ANR
STMN4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52287-NF
STMN4 cDNA ORF Clone, Mouse, C-His tag MG52287-CH
STMN4 cDNA ORF Clone, Mouse, N-His tag MG52287-NH
STMN4 cDNA ORF Clone, Mouse, C-HA tag MG52287-CY
STMN4 cDNA ORF Clone, Mouse, N-HA tag MG52287-NY
STMN4 cDNA ORF Clone, Mouse, C-Myc tag MG52287-CM
STMN4 cDNA ORF Clone, Mouse, N-Myc tag MG52287-NM
STMN4 qPCR Primer Pairs, Mouse MP202160

STMN4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STMN4 cDNA ORF Clone in Cloning Vector, Human HG25975-U
STMN4 cDNA ORF Clone, Human, untagged HG25975-UT
STMN4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25975-ACGLN
STMN4 cDNA ORF Clone, Human, C-GFPSpark® tag HG25975-ACG
STMN4 cDNA ORF Clone, Human, N-GFPSpark® tag HG25975-ANG
STMN4 cDNA ORF Clone, Human, C-OFPSpark® tag HG25975-ACR
STMN4 cDNA ORF Clone, Human, N-OFPSpark® tag HG25975-ANR
STMN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25975-CF
STMN4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25975-NF
STMN4 cDNA ORF Clone, Human, C-His tag HG25975-CH
STMN4 cDNA ORF Clone, Human, N-His tag HG25975-NH
STMN4 cDNA ORF Clone, Human, C-HA tag HG25975-CY
STMN4 cDNA ORF Clone, Human, N-HA tag HG25975-NY
STMN4 cDNA ORF Clone, Human, C-Myc tag HG25975-CM
STMN4 cDNA ORF Clone, Human, N-Myc tag HG25975-NM
info info
添加购物车成功! 添加购物车失败!