STAT5b cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51116-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All STAT5b Reagents

CRO Services

Product recommended


All STAT5b Reagents

STAT5b cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2361 bp
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5B with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT5b Background Information

Full Name
signal transducer and activator of transcription 5B

STAT5b cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STAT5b cDNA ORF Clone in Cloning Vector, Mouse MG51116-G
STAT5b cDNA ORF Clone, Mouse, untagged MG51116-UT
STAT5b cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51116-ACG
STAT5b Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51116-ACGLN
STAT5b cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51116-ANG
STAT5b cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51116-ACR
STAT5b cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51116-ANR
STAT5b cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51116-CF
STAT5b cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51116-NF
STAT5b cDNA ORF Clone, Mouse, C-His tag MG51116-CH
STAT5b cDNA ORF Clone, Mouse, N-His tag MG51116-NH
STAT5b cDNA ORF Clone, Mouse, N-HA tag MG51116-NY
STAT5b cDNA ORF Clone, Mouse, C-Myc tag MG51116-CM
STAT5b cDNA ORF Clone, Mouse, N-Myc tag MG51116-NM
STAT5b qPCR Primer Pairs, Mouse MP201067

STAT5b cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAT5b cDNA ORF Clone in Cloning Vector, Human HG17576-G
STAT5b cDNA ORF Clone, Human, untagged HG17576-UT
STAT5b Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17576-ACGLN
STAT5b cDNA ORF Clone, Human, C-GFPSpark® tag HG17576-ACG
STAT5b cDNA ORF Clone, Human, N-GFPSpark® tag HG17576-ANG
STAT5b cDNA ORF Clone, Human, C-OFPSpark® tag HG17576-ACR
STAT5b cDNA ORF Clone, Human, N-OFPSpark® tag HG17576-ANR
STAT5b cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17576-CF
STAT5b cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17576-NF
STAT5b cDNA ORF Clone, Human, C-His tag HG17576-CH
STAT5b cDNA ORF Clone, Human, N-His tag HG17576-NH
STAT5b cDNA ORF Clone, Human, C-HA tag HG17576-CY
STAT5b cDNA ORF Clone, Human, N-HA tag HG17576-NY
STAT5b cDNA ORF Clone, Human, C-Myc tag HG17576-CM
STAT5b cDNA ORF Clone, Human, N-Myc tag HG17576-NM
info info
添加购物车成功! 添加购物车失败!