STAT5a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51117-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STAT5a Reagents
CRO Services
Product recommended

All STAT5a Reagents
STAT5a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2382 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1482 G>A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + XbaI (6kb + 2.42kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
STAT5a cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAT5a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse STAT5a Gene Expression validated Image 2273
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
STAT5a cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AA959963 cDNA ORF Clone, Mouse;STAT5 cDNA ORF Clone, Mouse
STAT5a Background Information
Full Name
signal transducer and activator of transcription 5A

STAT5a cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STAT5a cDNA ORF Clone in Cloning Vector, Mouse MG51117-G
STAT5a cDNA ORF Clone, Mouse, untagged MG51117-UT
STAT5a cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51117-ACG
STAT5a Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51117-ACGLN
STAT5a cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51117-ANG
STAT5a cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51117-ACR
STAT5a cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51117-ANR
STAT5a cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51117-NF
STAT5a cDNA ORF Clone, Mouse, C-His tag MG51117-CH
STAT5a cDNA ORF Clone, Mouse, N-His tag MG51117-NH
STAT5a cDNA ORF Clone, Mouse, C-HA tag MG51117-CY
STAT5a cDNA ORF Clone, Mouse, N-HA tag MG51117-NY
STAT5a cDNA ORF Clone, Mouse, C-Myc tag MG51117-CM
STAT5a cDNA ORF Clone, Mouse, N-Myc tag MG51117-NM
STAT5a qPCR Primer Pairs, Mouse MP201068

STAT5a cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAT5a cDNA ORF Clone in Cloning Vector, Human HG10035-M
STAT5a cDNA ORF Clone, Human, untagged HG10035-UT
STAT5a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10035-ACGLN
STAT5a cDNA ORF Clone, Human, C-GFPSpark® tag HG10035-ACG
STAT5a cDNA ORF Clone, Human, N-GFPSpark® tag HG10035-ANG
STAT5a cDNA ORF Clone, Human, C-OFPSpark® tag HG10035-ACR
STAT5a cDNA ORF Clone, Human, N-OFPSpark® tag HG10035-ANR
STAT5a cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10035-CF
STAT5a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10035-NF
STAT5a cDNA ORF Clone, Human, C-His tag HG10035-CH
STAT5a cDNA ORF Clone, Human, N-His tag HG10035-NH
STAT5a cDNA ORF Clone, Human, C-HA tag HG10035-CY
STAT5a cDNA ORF Clone, Human, N-HA tag HG10035-NY
STAT5a cDNA ORF Clone, Human, C-Myc tag HG10035-CM
STAT5a cDNA ORF Clone, Human, N-Myc tag HG10035-NM
STAT5a qPCR Primer Pairs, Human HP100129
info info
添加购物车成功! 添加购物车失败!