STARD3NL cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52315-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All STARD3NL Reagents
CRO Services
Product recommended

All STARD3NL Reagents
STARD3NL cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Mouse STARD3 N-terminal like with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STARD3NL cDNA ORF Clone, Mouse, N-HA tag Alternative Names
0610035N01Rik cDNA ORF Clone, Mouse;6530409L22Rik cDNA ORF Clone, Mouse;AW124774 cDNA ORF Clone, Mouse;MENTHO cDNA ORF Clone, Mouse
STARD3NL Background Information
Full Name
STARD3 N-terminal like

STARD3NL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STARD3NL cDNA ORF Clone in Cloning Vector, Rat RG81066-U
STARD3NL cDNA ORF Clone, Rat, untagged RG81066-UT
STARD3NL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81066-ACGLN
STARD3NL cDNA ORF Clone, Rat, C-GFPSpark® tag RG81066-ACG
STARD3NL cDNA ORF Clone, Rat, C-OFPSpark® tag RG81066-ACR
STARD3NL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81066-CF
STARD3NL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81066-NF
STARD3NL cDNA ORF Clone, Rat, C-His tag RG81066-CH
STARD3NL cDNA ORF Clone, Rat, N-His tag RG81066-NH
STARD3NL cDNA ORF Clone, Rat, C-HA tag RG81066-CY
STARD3NL cDNA ORF Clone, Rat, N-HA tag RG81066-NY
STARD3NL cDNA ORF Clone, Rat, C-Myc tag RG81066-CM
STARD3NL cDNA ORF Clone, Rat, N-Myc tag RG81066-NM
STARD3NL qPCR Primer Pairs, Rat RP301030

STARD3NL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STARD3NL cDNA ORF Clone in Cloning Vector, Mouse MG52315-G
STARD3NL cDNA ORF Clone, Mouse, untagged MG52315-UT
STARD3NL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52315-ACGLN
STARD3NL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52315-ACG
STARD3NL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52315-ACR
STARD3NL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52315-CF
STARD3NL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52315-NF
STARD3NL cDNA ORF Clone, Mouse, C-His tag MG52315-CH
STARD3NL cDNA ORF Clone, Mouse, N-His tag MG52315-NH
STARD3NL cDNA ORF Clone, Mouse, C-HA tag MG52315-CY
STARD3NL cDNA ORF Clone, Mouse, C-Myc tag MG52315-CM
STARD3NL cDNA ORF Clone, Mouse, N-Myc tag MG52315-NM
STARD3NL qPCR Primer Pairs, Mouse MP202188

STARD3NL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STARD3NL cDNA ORF Clone in Cloning Vector, Human HG18299-U
info info
添加购物车成功! 添加购物车失败!