STAMBP cDNA ORF Clone, Mouse, N-His tag

Cat: MG51436-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All STAMBP Reagents
CRO Services
Product recommended

All STAMBP Reagents
STAMBP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Mouse STAM binding protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STAMBP cDNA ORF Clone, Mouse, N-His tag Alternative Names
5330424L14Rik cDNA ORF Clone, Mouse;5730422L11Rik cDNA ORF Clone, Mouse;Amsh cDNA ORF Clone, Mouse;AW107289 cDNA ORF Clone, Mouse;mKIAA4198 cDNA ORF Clone, Mouse
STAMBP Background Information
Full Name
STAM binding protein

STAMBP cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
STAMBP cDNA ORF Clone in Cloning Vector, Rabbit TG65080-G
STAMBP cDNA ORF Clone, Rabbit, untagged TG65080-UT
STAMBP Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65080-ACGLN
STAMBP cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65080-ACG
STAMBP cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65080-ANG
STAMBP cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65080-ACR
STAMBP cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65080-ANR
STAMBP cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65080-CF
STAMBP cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65080-NF
STAMBP cDNA ORF Clone, Rabbit, C-His tag TG65080-CH
STAMBP cDNA ORF Clone, Rabbit, N-His tag TG65080-NH
STAMBP cDNA ORF Clone, Rabbit, C-HA tag TG65080-CY
STAMBP cDNA ORF Clone, Rabbit, N-HA tag TG65080-NY
STAMBP cDNA ORF Clone, Rabbit, C-Myc tag TG65080-CM
STAMBP cDNA ORF Clone, Rabbit, N-Myc tag TG65080-NM

STAMBP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STAMBP cDNA ORF Clone in Cloning Vector, Rat RG88023-U
STAMBP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88023-ACGLN

STAMBP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STAMBP cDNA ORF Clone in Cloning Vector, Mouse MG51436-G
STAMBP cDNA ORF Clone, Mouse, untagged MG51436-UT
STAMBP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51436-ACGLN
STAMBP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51436-ACG
STAMBP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51436-ANG
STAMBP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51436-ACR
STAMBP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51436-ANR
STAMBP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51436-CF
STAMBP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51436-NF
STAMBP cDNA ORF Clone, Mouse, C-His tag MG51436-CH
STAMBP cDNA ORF Clone, Mouse, C-HA tag MG51436-CY
STAMBP cDNA ORF Clone, Mouse, N-HA tag MG51436-NY
STAMBP cDNA ORF Clone, Mouse, C-Myc tag MG51436-CM
STAMBP cDNA ORF Clone, Mouse, N-Myc tag MG51436-NM
STAMBP qPCR Primer Pairs, Mouse MP201320

STAMBP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STAMBP cDNA ORF Clone in Cloning Vector, Human HG14769-G
STAMBP cDNA ORF Clone, Human, untagged HG14769-UT
STAMBP cDNA ORF Clone, Human, C-GFPSpark® tag HG14769-ACG
STAMBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14769-ACGLN
STAMBP cDNA ORF Clone, Human, N-GFPSpark® tag HG14769-ANG
STAMBP cDNA ORF Clone, Human, C-OFPSpark® tag HG14769-ACR
STAMBP cDNA ORF Clone, Human, N-OFPSpark® tag HG14769-ANR
STAMBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14769-CF
STAMBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14769-NF
STAMBP cDNA ORF Clone, Human, C-His tag HG14769-CH
STAMBP cDNA ORF Clone, Human, N-His tag HG14769-NH
STAMBP cDNA ORF Clone, Human, C-HA tag HG14769-CY
STAMBP cDNA ORF Clone, Human, N-HA tag HG14769-NY
STAMBP cDNA ORF Clone, Human, C-Myc tag HG14769-CM
STAMBP cDNA ORF Clone, Human, N-Myc tag HG14769-NM
STAMBP qPCR Primer Pairs, Human HP103402
info info
添加购物车成功! 添加购物车失败!